| 00:00.06 | Cyrannian | Fergus_: I showed everyone my face, and they thought I was damn handsome. |
| 00:00.39 | Fergus_ | damn my secret identity got exposed |
| 00:02.00 | Cyrannian | http://photos-g.ak.fbcdn.net/hphotos-ak-snc7/395888_2930706512562_1551076158_a.jpg - Here's Fergus |
| 00:02.15 | Fergus_ | yummy |
| 00:02.22 | Fergus_ | wait that's not me |
| 00:02.23 | AdmiralPanda | Irskie: Fordanta talk mean but they really just don't want the KGGC to bugger everything up Kies style. Because they won't hold back against a Grox |
| 00:02.47 | Cyrannian | That totally is you. |
| 00:02.51 | Seldeen | Honest |
| 00:03.00 | Seldeen | Wormy, you look aweum |
| 00:03.13 | Fergus_ | http://www.sexblogjapan.com/japanese-sex/wp-content/uploads/2009/10/japanese-schoolgirl11.jpg |
| 00:03.28 | Wormy_STO | Thanks |
| 00:03.30 | Cyrannian | Fergus, we talked about this... |
| 00:03.32 | Seldeen | WUTDAHELLNO |
| 00:03.40 | Cyrannian | http://a4.sphotos.ak.fbcdn.net/hphotos-ak-snc6/179862_1868012505876_2552173_n.jpg - This is as close as we are going to get |
| 00:03.44 | Seldeen | NONONO THATS NOT LEGAL |
| 00:03.45 | MonetSTo | Wait... is than an android? |
| 00:03.57 | Fergus_ | lol |
| 00:04.04 | Wormy_STO | Wow Fergus, it seems you like wigs too |
| 00:04.12 | Seldeen | Lolwut is that, Cyr |
| 00:04.27 | Cyrannian | Hell no. |
| 00:04.31 | Cyrannian | I'm far more dapper. |
| 00:04.40 | Cyrannian | And wouldn't dream about wearing woman's clothes |
| 00:04.50 | Fergus_ | my feelings |
| 00:05.01 | Wormy_STO | YES mate. There is a commamder on Ds9 with a Scottish accent |
| 00:05.05 | Hachi_ | BTW peeps, I've started colouring Foshi's Exodus Form |
| 00:05.08 | Cyrannian | http://a7.sphotos.ak.fbcdn.net/hphotos-ak-snc6/206303_1982572769811_5672890_n.jpg - This is as close as I got |
| 00:05.11 | Hachi_ | So yeah, keep your eyes peeled |
| 00:05.28 | AdmiralPanda | http://memebase.com/2012/08/10/internet-memes-comixed-the-hero-we-all-need/#comments <- Unrelated but hilarious |
| 00:05.39 | Daaxri | Woooooooooooooooooooo |
| 00:05.43 | MonetSTo | Wormy: Have you heard abotu the two recent additions to my duty roster? |
| 00:06.24 | Cyrannian | Fergus_: We don't have any pictures together. :< |
| 00:06.31 | Fergus_ | we do |
| 00:06.34 | Fergus_ | remember in 2nd year |
| 00:06.34 | MonetSTo | I now have one Gorn and one El-Aurian crewmember. |
| 00:06.36 | Wormy_STO | Monet: Nope |
| 00:06.37 | Fergus_ | awards ceremony |
| 00:06.39 | Cyrannian | Ah yes |
| 00:06.41 | Seldeen | No, I was asking "Lulwut is that, Cyr?" as in the question is addressed to you and I'm not saying that is you. |
| 00:06.42 | Seldeen | LOL |
| 00:07.19 | Cyrannian | I don't like that one, it makes me look like a blue-eyed Naxi child |
| 00:07.23 | Seldeen | Irskaad: #nidlak-arkil |
| 00:07.24 | Cyrannian | *Nazi |
| 00:07.52 | Seldeen | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACK |
| 00:07.58 | Seldeen | I HAVE THAT WORD |
| 00:08.02 | Seldeen | HATE* |
| 00:08.10 | Cyrannian | http://a5.sphotos.ak.fbcdn.net/hphotos-ak-prn1/163932_172540192786341_6043356_n.jpg - That's me and Fergus on the left |
| 00:08.22 | Fergus_ | we're super kawaii desu~~~~ |
| 00:08.24 | Seldeen | I have the word in my vocab, but I prefer not to use it. Because I hate it. |
| 00:08.47 | Cyrannian | That was 2009, right? |
| 00:09.20 | AdmiralPanda | So Daaxri: Dey not gonna go Kies on people are they? |
| 00:09.29 | AdmiralPanda | Also, Cyrannian is hereby crowned the troll king of the universe |
| 00:09.35 | Seldeen | Who is that girl on the far left in the background? Lol, do you gaiz know them? |
| 00:09.45 | Seldeen | Her? WHATEVERLOL> |
| 00:09.45 | Cyrannian | I already had that title. |
| 00:09.57 | AdmiralPanda | You get a second one free, and a puppy |
| 00:10.15 | *** join/#sporewiki R17 (79362259@gateway/web/freenode/ip.121.54.34.89) |
| 00:10.19 | AdmiralPanda | Goddamn u for making a 'CBF' bubble around the Kraw Galaxy |
| 00:10.22 | Seldeen | REEBUTT! |
| 00:10.42 | Seldeen | :"DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD |
| 00:11.11 | Cyrannian | Fergus_: What does kawaii desu mean again? |
| 00:11.21 | R17 | Herro peopre |
| 00:11.38 | Seldeen | R17RWayTooFunny |
| 00:11.50 | R17 | Cyrannian: It's a Japanese term, in what context did Fergus use it? (It often means "cute" btw) |
| 00:12.01 | Daaxri | eek an R17 |
| 00:12.08 | *** join/#sporewiki Courtez2k12xxx (Courtez2k1@86-45-226-12-dynamic.b-ras1.mgr.mullingar.eircom.net) |
| 00:12.25 | Cyrannian | I showed a picture of us as young people, so I suppose we were kawaii desu. |
| 00:12.41 | Cyrannian | Especially me |
| 00:12.47 | Cyrannian | I was the cutest of them all |
| 00:12.49 | R17 | I see then. |
| 00:12.52 | Daaxri | http://www.joindota.com/en/news/3839-razer-mini-madness-with-its-gosu R17: Dota 2 has teams from the Phillipines, I wish them good luck in this tournament :3 |
| 00:13.04 | Cyrannian | ~glomp ChanServ |
| 00:13.04 | infobot | ACTION becomes fully animated as her eyes squint in an upside-down-U formation, gets a running start and tackle-glomps ChanServ |
| 00:13.06 | Cyrannian | Whoops |
| 00:13.07 | R17 | Daaxri: Interesting. |
| 00:13.19 | Cyrannian | ~glomp Courtez2k12xxx |
| 00:13.20 | infobot | ACTION becomes fully animated as her eyes squint in an upside-down-U formation, gets a running start and tackle-glomps Courtez2k12xxx |
| 00:13.42 | R17 | Most popular game in internet cafes around here in the Philippines is often Dota. |
| 00:13.50 | Seldeen | R17RWayTooFunny |
| 00:13.59 | Seldeen | You are rather funny indeed |
| 00:14.05 | Seldeen | Way too funny, actuall |
| 00:14.06 | Seldeen | y |
| 00:14.06 | Courtez2k12xxx | hi im courtney |
| 00:14.10 | Courtez2k12xxx | I think |
| 00:14.12 | Daaxri | R17: Lucky bastards |
| 00:14.25 | R17 | Seldeen: Lul probably |
| 00:14.39 | Daaxri | Over here seeing anything Dota is rare |
| 00:14.49 | Cyrannian | Fergus, acting like a girl isn't socially acceptable |
| 00:15.01 | Courtez2k12xxx | shup u filthy whore |
| 00:15.29 | DrodoEmpire | U shup, |
| 00:16.26 | Cyrannian | ~tackle Courtez2k12xxx |
| 00:16.26 | infobot | ACTION tackles Courtez2k12xxx to the ground. |
| 00:17.04 | Seldeen | ~mix Fergus_ |
| 00:17.12 | Seldeen | ~cook Fergus_ |
| 00:17.12 | infobot | ACTION throws Fergus_ in a big pan with veggies inside and cooks Fergus_ on 350 for an hour |
| 00:17.18 | Fergus_ | ouch |
| 00:17.20 | MonetSTo | With note to "Grochius III", the Grox and AGC are already in shaky post-war relations. |
| 00:17.27 | Cyrannian | That's not very nice. |
| 00:18.16 | AdmiralPanda | And everyone should know by now the Fordanta don't like the Grox one bit. I'm fairly sure I've explained why to everyone. |
| 00:18.43 | Daaxri | :P |
| 00:19.13 | MonetSTo | Don't blame us. |
| 00:19.19 | Cyrannian | Fergus_: Did you get your results yet? |
| 00:19.33 | Fergus_ | They arrive wednesday |
| 00:20.08 | AdmiralPanda | Dum waptor |
| 00:20.11 | Cyrannian | Excellent! In the nicest way possible, I hope you fail. |
| 00:20.23 | Cyrannian | So that we can spend another year together! |
| 00:20.24 | *** join/#sporewiki qwebirc485732 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 00:20.30 | Cyrannian | claps his hands excitedly |
| 00:20.37 | Daaxri | I thought you were Jo for a sec |
| 00:21.26 | Daaxri | brb |
| 00:21.27 | Wormy_STO | MonetSto: Rugan Skyl does talk an awful lot |
| 00:21.31 | Seldeen | UUUU |
| 00:21.44 | MonetSTo | Who? |
| 00:21.53 | R17 | Fordanta - "War begets war, and violence only brings violence" |
| 00:22.00 | Wormy_STO | The one who asks about Bajoran distilled kanar |
| 00:22.02 | R17 | Radux - this is EXACTLY WHAT WE WANT |
| 00:22.17 | R17 | (Radux was talking about Fordanta quote btw) |
| 00:22.22 | MonetSTo | Wormy_STO: I don't remember that guy. |
| 00:22.24 | Cyrannian | Did Oluap show his face yet? |
| 00:23.11 | Wormy_STO | He has a very slow voice and is lecturing me about a beverage Vulcans do not care for |
| 00:23.20 | *** join/#sporewiki IrskAndroid (~Irskaad@89.214.104.70) |
| 00:23.24 | Wormy_STO | Do I look like a bartender? |
| 00:23.44 | Cyrannian | Wormy_STO: Yes |
| 00:24.09 | Seldeen | Kerboom |
| 00:24.23 | MonetSTo | Suddenly I am re reminded of that scientist who spoke in one incredibly long unbroken sentence drifting from topic to topic it was quite hypnotic. |
| 00:26.42 | AdmiralPanda | I must summon Hachi_ =:3 |
| 00:26.50 | Hachi_ | Hmm? |
| 00:27.03 | R17 | Fordanta - "War begets war, and violence only brings violence" |
| 00:27.06 | R17 | Radux - this is EXACTLY WHAT WE WANT |
| 00:27.31 | AdmiralPanda | I'm gonna get to work later on the next part of the story |
| 00:27.31 | MonetSTo | I'm playing a mission called "temple offerings" where I have so far excahnged 5000 wrappings of Cardassian yamak Sauce, entertainment provisions and now a few crateloads of self-sealing stem bolts, all for a bajoran farmer who is stubbourn ot sell his land. it sounds familiar. |
| 00:27.43 | AdmiralPanda | Anything you'd like to see happen? |
| 00:29.03 | Hachi_ | I'd like to see some "badass walking in anger as he's getting hit" from Pyrotr |
| 00:29.59 | MonetSTo | Am I boring people with my references to Star Trek? |
| 00:30.56 | R17 | I don't know |
| 00:31.05 | Hachi_ | Of course not |
| 00:31.12 | Hachi_ | I'm just busy drawing Foshi again |
| 00:31.31 | MonetSTo | I'm just not sure if I am the only one who gets them. |
| 00:36.14 | *** join/#sporewiki Catface (46f2a3db@gateway/web/freenode/ip.70.242.163.219) |
| 00:36.45 | Catface | Hi |
| 00:36.50 | MonetSTo | Hi |
| 00:38.21 | GD12 | hello |
| 00:43.53 | AdmiralPanda | For the record, none of the ST references would make sense to me either way. |
| 00:44.34 | AdmiralPanda | Hachi_ : I'll probably write in that Pyotr has heavier armour than his fellows, to get around why he can take the hits better than the others |
| 00:45.09 | Catface | AdmiralPanda: I have a question. |
| 00:45.21 | *** join/#sporewiki GreatDestroyer12 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 00:45.47 | AdmiralPanda | Yes cat face? |
| 00:45.51 | MonetSTo | goodnight |
| 00:45.58 | Catface | Night |
| 00:45.59 | DrodoEmpire | See Ya, |
| 00:46.09 | Catface | And what is 1 + 2 if you live in a shoe? |
| 00:46.16 | *** join/#sporewiki qwebirc171919 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 00:46.20 | AdmiralPanda | Fish sticks. |
| 00:46.40 | Catface | Ah yes. Thank you, friend. |
| 00:47.04 | AdmiralPanda | You're welcome |
| 00:51.27 | Hachi_ | Finally finished Foshi's Exodus Form |
| 00:54.11 | Catface | Hachi_: No you didn't. |
| 00:54.20 | Hachi_ | Err |
| 00:54.26 | Wormy_STO | Turns out this 3 is a lucky number |
| 00:54.29 | Catface | This is all a dream. |
| 00:54.44 | Catface | You and I. |
| 00:54.50 | Wormy_STO | I won 100 Gold Latinum in Dabo (STO) by typing in 23, 3 and 32 |
| 00:54.59 | AdmiralPanda | And I'm a nightmare. A cute, cuddly nightmare |
| 00:55.31 | Catface | All your life is an illusion. |
| 00:55.54 | Catface | All that you love, all that you hate, and all that you make is all for not. |
| 00:56.07 | Catface | A false reality within your brain. |
| 00:56.25 | Catface | On fact you are only four years old and any minute you could wake up. |
| 00:56.28 | Catface | *In |
| 00:57.13 | AdmiralPanda | OOGABOOGAH! |
| 00:58.20 | Hachi_ | http://lotg.deviantart.com/art/Foshi-Exodus-Form-320389199 Foshi's Exodus Form |
| 01:03.25 | Hachi_ | test |
| 01:17.03 | *** join/#sporewiki BNSC (32474215@gateway/web/freenode/ip.50.71.66.21) |
| 01:17.42 | Hachi_ | Hello |
| 01:21.21 | GreatDestroyer12 | hello |
| 01:22.00 | AdmiralPanda | Is dat who I think it is? |
| 01:22.01 | DrodoEmpire | Hello, |
| 01:22.31 | Hachi_ | Yes, ACP |
| 01:22.35 | Hachi_ | That is BNSC |
| 01:22.48 | Cyrannian | Night! |
| 01:22.51 | Cyrannian | ~seen Catface |
| 01:22.55 | infobot | catface is currently on #sporewiki (46m 41s). Has said a total of 13 messages. Is idling for 26m 27s, last said: '*In'. |
| 01:22.56 | Cyrannian | Whoops |
| 01:23.00 | Cyrannian | ~seen Cyrannian |
| 01:23.00 | infobot | cyrannian is currently on #sporewiki (8h 33m 40s) #cyrannus (8h 33m 40s). Has said a total of 179 messages. Is idling for 0s, last said: '~seen Cyrannian'. |
| 01:23.02 | Catface | Yesh? |
| 01:23.05 | Catface | Oh |
| 01:23.07 | Cyrannian | Bye! |
| 01:23.08 | Hachi_ | Cya Cyrannian |
| 01:23.19 | Catface | I'll miss that lizard. |
| 01:23.29 | Hachi_ | Now you can play with buni |
| 01:23.44 | AdmiralPanda | =:3 |
| 01:24.01 | AdmiralPanda | Now Zoidberg is the popular one! |
| 01:45.06 | Wormy_STO | bye |
| 01:54.02 | *** join/#sporewiki GreatDestroyer12 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 01:57.21 | GreatDestroyer12 | ~seen DrodoEmpire |
| 01:57.25 | infobot | drodoempire <188950ea@gateway/web/freenode/ip.24.137.80.234> was last seen on IRC in channel #sporewiki, 35m 24s ago, saying: 'Hello,'. |
| 01:58.59 | *** join/#sporewiki Xho (562f4dfc@gateway/web/freenode/ip.86.47.77.252) |
| 01:59.27 | Xho | Bah! |
| 02:02.40 | *** join/#sporewiki R17 (79362259@gateway/web/freenode/ip.121.54.34.89) |
| 02:03.03 | R17 | back |
| 02:03.05 | R17 | what happened? |
| 02:08.40 | *** join/#sporewiki DrodoEmpire (8e44b7b0@gateway/web/freenode/ip.142.68.183.176) |
| 02:16.51 | DrodoEmpire | Hello, everyone. |
| 02:30.01 | GreatDestroyer12 | lol |
| 02:41.03 | *** join/#sporewiki qwebirc349687 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 02:43.31 | *** join/#sporewiki Drodo (8e44b7b0@gateway/web/freenode/ip.142.68.183.176) |
| 02:43.54 | GreatDestroyer12 | hello |
| 02:44.09 | DrodoEmpire | I'm on #Spore, |
| 02:44.15 | DrodoEmpire | continue? |
| 03:08.10 | Cesterity | We is rping, |
| 03:27.18 | *** join/#sporewiki Cesterity (8e44b7b0@gateway/web/freenode/ip.142.68.183.176) |
| 03:30.18 | *** join/#sporewiki GreatDestroyer12 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 03:44.18 | *** join/#sporewiki Cesterity (8e44b7b0@gateway/web/freenode/ip.142.68.183.176) |
| 05:13.25 | *** join/#sporewiki GreatDestroyer12 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 05:13.28 | GreatDestroyer12 | wow |
| 05:13.30 | GreatDestroyer12 | you are still on? |
| 05:13.37 | GreatDestroyer12 | just had lunch |
| 05:14.37 | DrodoEmpire | Ya, |
| 05:14.47 | GreatDestroyer12 | continue on #Spore? |
| 05:15.03 | GreatDestroyer12 | btw Viaze is still pretty brainswashed |
| 05:15.14 | GreatDestroyer12 | but cesterity will convice him of the evil of the tyranny |
| 06:07.13 | *** join/#sporewiki Jepardi (d5f38d50@gateway/web/freenode/ip.213.243.141.80) |
| 06:07.31 | Jepardi | Hi |
| 06:09.04 | Cesterity | Hello, |
| 06:09.21 | Cesterity | We're rp-ing on #Spore, |
| 06:09.30 | Cesterity | So, |
| 06:09.37 | Cesterity | Kinda busy. |
| 06:23.15 | *** join/#sporewiki R17 (79362259@gateway/web/freenode/ip.121.54.34.89) |
| 06:36.24 | Jepardi | Hi |
| 07:28.41 | R17 | tset |
| 07:42.35 | R17 | tset |
| 07:48.21 | Cesterity | Night everyone. |
| 08:03.04 | *** join/#sporewiki Imperios (b2420661@gateway/web/freenode/ip.178.66.6.97) |
| 08:04.02 | Imperios | Hi |
| 08:36.36 | *** join/#sporewiki Liquid_Ink (79d0badc@gateway/web/freenode/ip.121.208.186.220) |
| 08:43.04 | *** join/#sporewiki AdmiralPanda (3ce4c252@gateway/web/freenode/ip.60.228.194.82) |
| 08:43.34 | R17_DoW | Herro peopre |
| 08:47.13 | Imperios | Hiya |
| 08:48.01 | Liquid_Ink | Hello. |
| 08:48.21 | Liquid_Ink | What do the Russians think of the Ukrainians? |
| 08:49.39 | Imperios | Depends on a Russian |
| 08:49.53 | Imperios | But certainly not of a high esteem |
| 08:49.55 | Imperios | Generally |
| 08:51.23 | Liquid_Ink | How about the Belarusians? |
| 09:17.56 | AdmiralPanda | Hi Impeh |
| 09:23.13 | *** join/#sporewiki Technobliterator (1f3561f2@gateway/web/freenode/ip.31.53.97.242) |
| 09:30.09 | *** join/#sporewiki Imperios (b24219a0@gateway/web/freenode/ip.178.66.25.160) |
| 09:30.13 | Imperios | Hi Jo |
| 09:30.15 | Imperios | And uvvas |
| 09:32.31 | Imperios | People? |
| 09:34.18 | Technobliterator | hi |
| 09:35.42 | Imperios | I am trying to play DotA |
| 09:35.51 | Imperios | I wish Oluap could be ther |
| 09:36.01 | Imperios | When is he coming usually? |
| 09:36.05 | Imperios | You seem to know that |
| 09:39.59 | Technobliterator | uhm...in about 2/3 hours time |
| 09:42.34 | AdmiralPanda | Hi Techno |
| 10:18.49 | *** join/#sporewiki Jepardi (d5f38d50@gateway/web/freenode/ip.213.243.141.80) |
| 10:18.55 | Jepardi | Hi |
| 10:22.37 | *** join/#sporewiki R17 (79362259@gateway/web/freenode/ip.121.54.34.89) |
| 10:22.43 | R17 | herro peopre |
| 10:24.46 | Imperios | Hi |
| 10:24.54 | *** join/#sporewiki Monet (2ed0400f@gateway/web/qwebirc/irc.wikia.com/ip.46.208.64.15) |
| 10:25.00 | Jepardi | Hi |
| 10:25.00 | Imperios | Hi |
| 10:25.02 | Monet | Hello. |
| 10:25.05 | R17 | yay Mon |
| 10:25.07 | R17 | herro Mon |
| 10:25.42 | Liquid_Ink | Hello. |
| 10:25.53 | Monet | Imperios said hi in under 4 minutes? Impossibru! |
| 10:25.56 | Imperios | BTW Technobliterator |
| 10:26.01 | Imperios | I wanted to ask you something |
| 10:26.05 | Technobliterator | yeah..? |
| 10:26.14 | Imperios | Since you had experience in galaxies and stuff - Ottzello, Borealis and Stuff |
| 10:26.27 | Imperios | i ask you: what should I add to Andromeda to make it a better galaxy overall? |
| 10:26.43 | Technobliterator | urm...i dunno |
| 10:26.56 | Technobliterator | I always rtied to "characterize" those two galaxies |
| 10:26.59 | Imperios | Just more empires or perhaps more unifying shtick like pan-galactic cultural things |
| 10:27.11 | Technobliterator | yeah the cultural thing maybe |
| 10:27.21 | Technobliterator | if you look, Borealis and Ottzello are pretty dystopian |
| 10:27.36 | Imperios | Yeah, that's what defines them |
| 10:27.43 | Technobliterator | but Borealis has a mystery about it, with the Kormacvar and stuff and their technology |
| 10:27.48 | Technobliterator | these things define the galaxy |
| 10:27.59 | Liquid_Ink | How do Russians feel about Belarusians? |
| 10:30.43 | Liquid_Ink | I've asked that twice now and you haven't answered, are they a forbidden topic? |
| 10:31.08 | Imperios | Well |
| 10:31.15 | Imperios | The thoughts about Belarusians are mixed |
| 10:31.30 | Imperios | Ukrainians are generally considered dum |
| 10:31.39 | Imperios | And greedy, dicks like that |
| 10:33.23 | Jepardi | peep |
| 10:37.00 | Liquid_Ink | dəəd |
| 10:44.53 | Jepardi | peep |
| 10:49.24 | *** join/#sporewiki R17 (79362259@gateway/web/freenode/ip.121.54.34.89) |
| 10:50.22 | R17 | what happen while my firefox crash? |
| 10:50.50 | Imperios | [14:44] <Jepardi> peep |
| 10:52.59 | Jepardi | smacks Impy |
| 10:56.28 | Liquid_Ink | [20:36] <Liquid_Ink> dəəd |
| 10:59.47 | Jepardi | smacks Liquid_Ink |
| 11:00.02 | Liquid_Ink | throws Belarusians at Jepardi. |
| 11:00.37 | Jepardi | throws Finns at Liquid_ink |
| 11:00.43 | *** join/#sporewiki Seldeen (18d7c951@gateway/web/qwebirc/irc.wikia.com/ip.24.215.201.81) |
| 11:00.50 | Seldeen | ReCaptcha of the Day: and dandhat |
| 11:00.57 | Seldeen | Hullo |
| 11:01.01 | Jepardi | Hi |
| 11:01.04 | Liquid_Ink | throws Georgians at Jepardi. |
| 11:01.13 | Liquid_Ink | (both the country and the US state.) |
| 11:01.15 | Jepardi | throws Swedish at Liquid_ink |
| 11:01.19 | Seldeen | Inky! Impy! |
| 11:01.24 | Liquid_Ink | Hello! |
| 11:01.29 | Seldeen | Yaaay |
| 11:01.31 | Seldeen | Hi |
| 11:04.01 | Liquid_Ink | http://images.wikia.com/spore/images/c/cb/DemonCarving.png Looks more like a clown than a demon. |
| 11:04.47 | Seldeen | LOL |
| 11:04.59 | Seldeen | Scary clown? |
| 11:11.03 | AdmiralPanda | We must summon Hachi |
| 11:11.15 | Liquid_Ink | With carrots! |
| 11:11.35 | AdmiralPanda | Agreed |
| 11:11.43 | R17 | but he no like carrots |
| 11:11.47 | Imperios | Back |
| 11:11.48 | R17 | weird buni |
| 11:11.48 | Imperios | Hi Seldeen |
| 11:12.02 | AdmiralPanda | Then we use lettuce! |
| 11:12.13 | AdmiralPanda | And women, many women |
| 11:12.24 | AdmiralPanda | grabs R17 * |
| 11:12.27 | AdmiralPanda | Got the first one! |
| 11:13.10 | R17 | Wtf |
| 11:13.22 | Liquid_Ink | grabs Techno. |
| 11:13.26 | R17 | I WAS CROSSDRESSING DAMMIT |
| 11:13.32 | Liquid_Ink | A self proclaimed woman. |
| 11:13.48 | R17 | (that was to Panda) |
| 11:13.48 | Imperios | Dum R17 |
| 11:14.02 | R17 | Panda dammit I was crossdressing I'm not a woman |
| 11:14.28 | AdmiralPanda | Suuuuuuure |
| 11:14.40 | *** join/#sporewiki GreatDestroyer12 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 11:14.42 | AdmiralPanda | Wait what? You just admitted to cross-dressing? |
| 11:14.46 | GreatDestroyer12 | wut |
| 11:14.54 | GreatDestroyer12 | i get here and the first thing i see is that |
| 11:14.55 | GreatDestroyer12 | what happened |
| 11:15.02 | R17 | Panda: YES |
| 11:15.04 | AdmiralPanda | <PROTECTED> |
| 11:15.10 | Seldeen | Nuuu not the lettuce ladies of peta (People for the Ethical Treatment of Animals (while deciding to be butt naked in protests against weird forms of animal abuse, while standing amongst also-naked prrnstars in protest, too.)) |
| 11:15.15 | AdmiralPanda | [21:12] <AdmiralPanda> Then we use lettuce! |
| 11:15.22 | AdmiralPanda | <PROTECTED> |
| 11:15.26 | Seldeen | Nuuu not the lettuce ladies of peta (People for the Ethical Treatment of Animals (while deciding to be butt naked in protests against weird forms of animal abuse, while standing amongst also-naked prrnstars in protest, too.)) |
| 11:15.29 | AdmiralPanda | <PROTECTED> |
| 11:15.29 | R17 | then Panda grabbed me |
| 11:15.37 | AdmiralPanda | <PROTECTED> |
| 11:15.41 | R17 | and I reveal that I was a cross-dressing guy |
| 11:15.42 | Seldeen | Sorry, that was just out of place just there |
| 11:16.03 | AdmiralPanda | PETA dum |
| 11:16.04 | GreatDestroyer12 | i c |
| 11:16.41 | R17 | I was crossdressing |
| 11:16.44 | Seldeen | I know! Their vids gave me bad dreams! |
| 11:17.03 | R17 | Panda thought I was a woman, he was collecting women to summon Hachi, and mistook me for one while I was crossdressing and wearing a wig. |
| 11:17.26 | Imperios | sacrifices R17 to Slaanesh |
| 11:18.01 | Seldeen | BTW, I think it's actually (Playmates for the Ethical Treatment of Animals (and Actresses)) |
| 11:18.52 | Seldeen | lol because they use pamanderson in ads. I saw while I actually was looking thru peta shite. |
| 11:19.11 | GreatDestroyer12 | is this PETA naked > fur |
| 11:20.06 | Liquid_Ink | Lets dump them in Antarctica naked. |
| 11:20.33 | GreatDestroyer12 | dum PETA |
| 11:21.12 | Liquid_Ink | IKEA's much better. |
| 11:21.18 | Liquid_Ink | Even though they are not related. |
| 11:21.40 | GreatDestroyer12 | you guys saw the dominatus faust right |
| 11:22.21 | Seldeen | Agreed. IKEA is awesome. |
| 11:22.51 | Liquid_Ink | It his clearly Sweden's overseas empire. |
| 11:23.57 | *** join/#sporewiki Xho (5ac81198@gateway/web/freenode/ip.90.200.17.152) |
| 11:23.59 | Imperios | Swedesia |
| 11:24.07 | Imperios | YAY DUM XHODDIES |
| 11:24.13 | Xho | ~cook Imperios |
| 11:24.14 | infobot | ACTION throws Imperios in a big pan with veggies inside and cooks Imperios on 350 for an hour |
| 11:24.22 | Imperios | ded |
| 11:24.33 | Imperios | rises as a zombie and proceeds to eat Xho |
| 11:24.43 | Xho | ~cook Imperios |
| 11:24.43 | infobot | ACTION throws Imperios in a big pan with veggies inside and cooks Imperios on 350 for an hour |
| 11:24.50 | Seldeen | SWEDISH MEATBALLS!!! :"D |
| 11:24.53 | Imperios | is not a cooked zombie |
| 11:24.55 | Imperios | *now |
| 11:25.05 | Liquid_Ink | Hello Xho. |
| 11:25.09 | Imperios | burns Xho |
| 11:25.14 | Liquid_Ink | Oluap didn't befirend me on Steam. |
| 11:25.21 | Xho | "It is intersting for me to know as I am very interested in the reproduction of animals." - Luc |
| 11:25.22 | Liquid_Ink | I prefer you over him now. |
| 11:25.27 | GreatDestroyer12 | hello |
| 11:25.28 | Xho | ~cook Imperios |
| 11:25.28 | infobot | ACTION throws Imperios in a big pan with veggies inside and cooks Imperios on 350 for an hour |
| 11:25.39 | Xho | I will cook you to charcoal |
| 11:25.44 | Imperios | Cookception |
| 11:25.45 | Imperios | Dur |
| 11:25.53 | GreatDestroyer12 | ~incinerate Imperios |
| 11:26.00 | Xho | Liquid_Ink: Glad to know I was picked over -_- |
| 11:26.13 | Seldeen | ~burn Impy |
| 11:26.14 | infobot | ACTION pours gasoline all over Impy, ignites the fire, and then enjoys some toasty marshmallows with the glorious blaze |
| 11:26.22 | Seldeen | There you go. |
| 11:26.30 | Seldeen | ~GLaDOS |
| 11:26.36 | Seldeen | Darn... |
| 11:27.01 | GreatDestroyer12 | anyway bye |
| 11:27.03 | AdmiralPanda | I know lots of people interested in the reproductory systems of animals |
| 11:30.27 | *** join/#sporewiki Tarrasque (Irskaad@95.69.21.132) |
| 11:30.34 | R17 | Eek a Krauna |
| 11:30.35 | AdmiralPanda | Hi Irskie |
| 11:30.39 | Tarrasque | D'oh |
| 11:31.03 | AdmiralPanda | <PROTECTED> |
| 11:31.05 | *** join/#sporewiki Technobliterator (1f3561f2@gateway/web/freenode/ip.31.53.97.242) |
| 11:31.12 | R17 | Hi Tech |
| 11:31.15 | Technobliterator | hi |
| 11:31.24 | Tarrasque | eek a jo |
| 11:32.03 | Imperios | Hi Tarrasque |
| 11:32.10 | R17 | he is Irsk |
| 11:32.17 | Imperios | Irskaad: you should remove that nickname too |
| 11:33.28 | Technobliterator | Vryonorg y u still unavailable |
| 11:33.36 | Irskaad | cuz not monday |
| 11:33.40 | Technobliterator | oh |
| 11:33.41 | Technobliterator | dum |
| 11:34.01 | Technobliterator | did you like have to get a replacement broadband or something |
| 11:34.12 | Seldeen | AAAAHAHAAAA |
| 11:34.19 | Seldeen | IRSKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD |
| 11:34.25 | Technobliterator | uh |
| 11:34.26 | Technobliterator | wtf |
| 11:34.27 | Irskaad | No. I'm on vacation. |
| 11:34.30 | Technobliterator | oh |
| 11:34.35 | Technobliterator | to that same village? |
| 11:34.41 | Irskaad | Yes. |
| 11:34.43 | Irskaad | Again. |
| 11:34.58 | Technobliterator | how lame |
| 11:35.03 | Imperios | Village is a village? |
| 11:35.11 | Imperios | Now I understand why do you hate nature :> |
| 11:35.15 | Imperios | *as in |
| 11:35.34 | Technobliterator | no irsk hates nature because it bores hi |
| 11:35.38 | Technobliterator | *him |
| 11:35.55 | Irskaad | Both are reasons why |
| 11:35.57 | Monet | No computers. |
| 11:36.01 | Seldeen | You should get to love nature. Really |
| 11:36.07 | Irskaad | lolno |
| 11:36.12 | Seldeen | Nature = Life |
| 11:36.15 | Irskaad | The only nature I'll love is in Dota 2 |
| 11:36.20 | Irskaad | You can juke in it |
| 11:36.21 | Technobliterator | lol |
| 11:36.22 | Seldeen | Do you like studying life |
| 11:36.23 | Irskaad | Nom it for hp |
| 11:36.39 | Seldeen | Nom tomato for energy |
| 11:36.39 | AdmiralPanda | Irskaad no love nature, so no love himself, so he mad |
| 11:36.43 | AdmiralPanda | All makes sense nao |
| 11:36.47 | Seldeen | LILOL |
| 11:36.58 | Irskaad | You're up early Seld |
| 11:37.05 | Monet | Seldeen: I think without Central Park, New York would be very different, right? |
| 11:37.17 | Irskaad | I think it would be the same and/or better |
| 11:37.28 | Technobliterator | nah, it wouldn't |
| 11:37.30 | Technobliterator | for you, maybe |
| 11:37.36 | Technobliterator | but for a lot of people it would be bad |
| 11:37.56 | Technobliterator | Whether you like it or not fair enough if you don't, but you have to remember that there's people who love nature and like a bit of fresh air |
| 11:38.11 | Imperios | Of course |
| 11:38.19 | Imperios | You do live outside of a big city right, Irskaad? |
| 11:38.45 | Irskaad | Do you mean right now? |
| 11:39.01 | Monet | <PROTECTED> |
| 11:39.01 | Technobliterator | no he means in general |
| 11:39.09 | Technobliterator | i live in a big city hur |
| 11:39.18 | Imperios | So do I |
| 11:39.30 | Irskaad | Back in my normal home? I live in a suburb yes, and it takes me 5 mins to get to the metro to lisbon |
| 11:39.31 | Technobliterator | still |
| 11:39.45 | Technobliterator | i bet irsk would love a holiday in centre parcs:) |
| 11:39.58 | Imperios | Parks are good |
| 11:40.03 | Irskaad | goes to the nearest internet cafe for Dota 2 |
| 11:40.13 | Irskaad | If he's taken there |
| 11:40.13 | Technobliterator | no not a park |
| 11:40.16 | Monet | There is a big shopping centre. |
| 11:40.25 | Technobliterator | monet you been centre parcs? |
| 11:40.40 | Monet | Technobliterator: Once or twice. |
| 11:40.45 | Technobliterator | OMG |
| 11:40.52 | Technobliterator | I LOVE CENTRE PARCS!!!:) |
| 11:40.58 | Irskaad | What is that |
| 11:40.59 | Technobliterator | it's such a legend holiday |
| 11:41.01 | Imperios | What is a Centre Parc |
| 11:41.04 | Irskaad | ^ |
| 11:41.04 | Technobliterator | well basicaly |
| 11:41.04 | Imperios | People |
| 11:41.08 | Monet | I cannot imagine New York without Central Park or London without Hyde Park. |
| 11:41.09 | Imperios | No seriously tell us |
| 11:41.15 | Irskaad | I can |
| 11:41.17 | Technobliterator | we will if you let us |
| 11:41.24 | Imperios | Ok |
| 11:41.37 | Technobliterator | Essentially, massive dome in the forest |
| 11:41.56 | Technobliterator | In this dome you have swimming pool, shopping centre, cafe's and shit |
| 11:42.07 | Irskaad | SHELTER |
| 11:42.07 | Technobliterator | and you get a "villa" to yourself just outside the dome |
| 11:42.17 | Imperios | Looks good |
| 11:42.20 | Monet | There is also a big hotel. |
| 11:42.25 | Technobliterator | yep |
| 11:42.34 | Technobliterator | if you can't afford the villa that is |
| 11:42.44 | Imperios | There is a park close to my home |
| 11:42.58 | Technobliterator | it's such a nice place to visit |
| 11:43.01 | Imperios | Central Park of Culture and Recreation |
| 11:43.09 | Monet | I believe I once took a family holiday to one of the villas, or was it a bungalow. |
| 11:43.12 | Imperios | Russian parks are all like that |
| 11:43.20 | Technobliterator | so irsk what's the village like? |
| 11:43.31 | Irskaad | Boring as fuck there's barely anything here |
| 11:43.36 | Monet | Centre parks place is beautiful and there are conifers everywhere. |
| 11:43.57 | Technobliterator | centre parcs has stuff to do hur |
| 11:44.13 | Technobliterator | so like is a literal village with a maeket and crap? |
| 11:45.07 | Irskaad | Yes, the nearest city is about 10 Km away |
| 11:45.39 | Technobliterator | and internet connection is crap |
| 11:45.46 | Irskaad | Yes. |
| 11:45.47 | Imperios | Never stayed in a village |
| 11:45.52 | Seldeen | It'd actually be way worse |
| 11:46.10 | Technobliterator | what kind of stuff is there to do that you don't want to do? |
| 11:46.40 | Seldeen | Look at the 1811 commissioner's plan |
| 11:46.43 | Irskaad | Farming, church, traditional festivals... |
| 11:46.53 | Technobliterator | how boring |
| 11:47.00 | Seldeen | you'll see how tiny nyc would've been, just overcrowded. |
| 11:47.09 | Technobliterator | i don't blame you, i wouldn't like that either |
| 11:47.21 | Seldeen | OOH Farming is harvesting NATURE!!! HUR |
| 11:47.24 | Technobliterator | centre parcs has stuff to do :v |
| 11:48.16 | Seldeen | Skurrrt |
| 11:48.21 | R17 | just about anything that isn't man-made can easily relate to nature/is nature. |
| 11:48.45 | Liquid_Ink | Things that are made can be debated as nature. |
| 11:51.01 | Monet | A lot of natural stuff can compete with what is made in a lab. |
| 11:51.17 | Irskaad | I like man made stuff better |
| 11:51.26 | Irskaad | Because I can trust humanity more than nature |
| 11:51.56 | Seldeen | Skirts. |
| 11:51.59 | Monet | I'm on a course of aloe vera and peppermint oil and I disagree. |
| 11:52.24 | Irskaad | Your opinion. Not worth arguing. |
| 11:52.27 | Seldeen | Skirts. |
| 11:52.30 | AdmiralPanda | I don't trust man-made stuff more than natural, and I'm a bloody scientist (in training) |
| 11:52.32 | R17 | What about skirts? |
| 11:52.52 | Seldeen | Nelradiates are wearing skirts now. AND "FLARES" |
| 11:53.00 | R17 | I see then |
| 11:53.07 | Seldeen | AND HATS |
| 11:53.31 | Seldeen | Fashionable Armor for males |
| 11:54.03 | Monet | I believe there was a new scientist arrticle that suggested ancient Chinese remedies can actually compete wit lab-made chemicals. |
| 11:55.12 | Imperios | hM |
| 11:55.13 | Imperios | Hm |
| 11:56.02 | Monet | And up until the 50s a lot of these lab-made chemicals were proccessed plant extracts. |
| 11:56.06 | Seldeen | http://www.spore.com/static/image/500/860/538/500860538864_lrg.png <--- Realistic re-creation of my first creation, the Slendaptosaurus |
| 11:56.09 | AdmiralPanda | Lab-made chemicals are almost entirely based on natural materials even today |
| 11:56.40 | Irskaad | Man made medicine is tested over and over again in labs so it must be better, no offense to anyone |
| 11:57.26 | Monet | All medicines are tested thoroughly otherwise they wouldn't be legalised. |
| 11:57.42 | Irskaad | Exactly |
| 11:57.57 | Monet | That includes the natural-made stuff :V |
| 11:58.33 | Irskaad | Meh |
| 11:59.01 | AdmiralPanda | Irskaad: Natural medicine undergoes the same test. |
| 11:59.44 | AdmiralPanda | Also, those tests aren't always accurate. Native medicines are known to work as well or better than most artificial equivalents, it's just we've lost the knowledge of those native medicines |
| 11:59.51 | Seldeen | AND HATS |
| 11:59.56 | Seldeen | :"D |
| 11:59.56 | Monet | It is predicted that there are countless plant species in the rainforests that could revolutionise modern medicine, which we will never get to know due to deforestation. |
| 12:00.21 | AdmiralPanda | Oh by the way, I have one very important thing to say to everyone here |
| 12:00.52 | Seldeen | VAT |
| 12:01.17 | *** join/#sporewiki OluapPlayer (bada0733@gateway/web/freenode/ip.186.218.7.51) |
| 12:01.17 | *** mode/#sporewiki [+o OluapPlayer] by ChanServ |
| 12:01.42 | AdmiralPanda | An Australian invented the directed plasma drive. The planet can form a line behind us and kiss our dusty red arse |
| 12:01.45 | Liquid_Ink | Oluap you evil evil man. |
| 12:01.58 | Irskaad | YAY KO *hug* |
| 12:02.18 | Technobliterator | dum playa |
| 12:03.10 | Liquid_Ink | Very dum. |
| 12:03.13 | AdmiralPanda | Dis long ficshun for something that happened so quickly |
| 12:03.17 | Seldeen | OluapPlayer: http://www.spore.com/static/image/500/860/538/500860538864_lrg.png <--- Realistic re-creation of my first creation, the Slendaptosaurus |
| 12:03.33 | OluapPlayer | Why are you showing me that |
| 12:03.46 | AdmiralPanda | http://spore.wikia.com/wiki/User:Spriggs077/Ideas#Fic_with_Luc <- Warning, this fic is very looooooong, so you don't have to read it |
| 12:03.55 | AdmiralPanda | If you do though, any feedback is welcome |
| 12:04.33 | Seldeen | Because. |
| 12:04.44 | Liquid_Ink | rides off into the sunset. Probably to get the cavalry, so we can chase Oluap from Britian to Persia. |
| 12:04.57 | Liquid_Ink | Or Brazil to Canada. Whatever. |
| 12:05.03 | Seldeen | OOH, ROMNEY JUST SAID PAUL RYAN WILL BE HIS RUNNING MATE! |
| 12:05.13 | Technobliterator | omg man... |
| 12:05.27 | Irskaad | Lunch baaaaaaaaaaaaaaaai |
| 12:05.28 | Imperios | Hi |
| 12:05.34 | AdmiralPanda | (Not australian) I assume that's bad |
| 12:05.48 | AdmiralPanda | As in the politics is not Australian, so I don't know about it |
| 12:05.51 | Imperios | OluapPlayer? |
| 12:06.02 | OluapPlayer | What |
| 12:06.08 | Imperios | On the wild track! |
| 12:06.27 | Imperios | mind controls a Centaur to attack OluapPlayer while hurling spears at him |
| 12:07.01 | Seldeen | Yes that is bad. Romney is baddie repubbikin |
| 12:07.06 | OluapPlayer | ? |
| 12:07.08 | Technobliterator | kk |
| 12:07.15 | AdmiralPanda | Ok then |
| 12:07.17 | Imperios | Dum |
| 12:07.23 | AdmiralPanda | Wait, he's the Amercia guy right? |
| 12:07.25 | Imperios | basically I plan to join you guys soon |
| 12:07.34 | Imperios | So I am training at normal DotA to play DotA 2 |
| 12:07.42 | Imperios | My favourite hero is Enchantress so far Oluap |
| 12:07.51 | OluapPlayer | Oh |
| 12:08.03 | Imperios | She is a jungler right? |
| 12:08.11 | OluapPlayer | Yeah she can jungle |
| 12:08.14 | Imperios | So she has to stay in the forest killing creeps, right? |
| 12:08.19 | Imperios | What I do not understand |
| 12:08.25 | OluapPlayer | She can play in a lane too |
| 12:08.33 | Imperios | When should I stop killing creeps and come laning |
| 12:09.00 | OluapPlayer | When an ally is in danger or the tower is under attack |
| 12:09.13 | Imperios | I c |
| 12:09.13 | OluapPlayer | or when your allies are gonna gank next to your jungle, you can go there and help |
| 12:09.26 | Imperios | So I should generally stay in the jungle but come to help occasionally |
| 12:09.27 | Imperios | I c |
| 12:09.37 | OluapPlayer | Enchantress' ultimate is some scary stuff |
| 12:09.37 | Imperios | My second next fav hero is Ursa |
| 12:09.44 | Imperios | she hurls spears like crazy |
| 12:09.53 | Technobliterator | i don't get |
| 12:09.53 | AdmiralPanda | As far as LoL is concerned, a jungler's job is to tip the balance in ganks |
| 12:09.58 | Technobliterator | whart is laning??? |
| 12:10.03 | OluapPlayer | dum |
| 12:10.15 | OluapPlayer | Lanes = the paths were the creeps walk |
| 12:10.23 | OluapPlayer | Laning = killing enemy creeps for gold and exp |
| 12:10.37 | Imperios | I wonder, should I play Ench or Ursa? |
| 12:10.47 | Imperios | For what I have seen Ench is stronger, at least as lower levels |
| 12:11.02 | OluapPlayer | Ursa is a carry so unless you know what you're doing, don't play as him |
| 12:11.03 | Technobliterator | "stop killing creeps and come laning" |
| 12:11.04 | Technobliterator | huh? |
| 12:11.12 | Technobliterator | aren't they the same thing |
| 12:11.13 | OluapPlayer | He's also very easy to counter |
| 12:11.21 | OluapPlayer | Neutral creeps =/= lane creeps |
| 12:11.31 | Technobliterator | oh...but neutral creeps are fuckhard |
| 12:11.43 | AdmiralPanda | Not for jungle champions |
| 12:11.51 | OluapPlayer | There are weak, medium, hard and ancient creeps |
| 12:11.53 | OluapPlayer | and Roshan |
| 12:12.19 | Technobliterator | urrm...ok |
| 12:12.22 | Imperios | Technobliterator: Not when you mind control them :> |
| 12:12.22 | Technobliterator | i c |
| 12:12.44 | OluapPlayer | Roshan is technically an ancient creep but he's too powerful to fit with the rest |
| 12:13.04 | Technobliterator | Now that I've played Dota 2 early invite I can see why they haven't released it as a full game yet |
| 12:13.22 | Technobliterator | At this current stage it's inaccessible as hell and there's no in-game advice or tutorial |
| 12:13.33 | OluapPlayer | Dota will always be like that |
| 12:13.38 | OluapPlayer | even when tutorial mode is out |
| 12:13.51 | AdmiralPanda | Yeah, same with LoL |
| 12:13.52 | OluapPlayer | Also there are still 18 more heroes to be added before the game properly releases |
| 12:14.04 | AdmiralPanda | Each champion has unique strategies, and multiple possible strategies, so it's too much to cover |
| 12:14.05 | Technobliterator | Getting owned and humiliated? Always be there |
| 12:14.14 | Technobliterator | Having any clue what the fuck to do? A tutorial can solve this |
| 12:14.27 | OluapPlayer | If you start whining again I won't play with you anymore |
| 12:14.49 | Technobliterator | i'm not whining... |
| 12:15.01 | *** join/#sporewiki Zmr56 (5225ff69@gateway/web/qwebirc/irc.wikia.com/ip.82.37.255.105) |
| 12:15.06 | Technobliterator | hi |
| 12:15.12 | Zmr56 | Hello everyone |
| 12:15.49 | Zmr56 | Who's Seldeen? |
| 12:20.09 | AdmiralPanda | Anywho, I started playing Skyrim again for teh luls |
| 12:20.20 | Irskaad | Oluap: Jo: Who's winning? |
| 12:22.14 | OluapPlayer | We're not playing right now |
| 12:22.20 | Irskaad | Kay |
| 12:22.38 | Irskaad | dum i wish it was munday |
| 12:22.56 | Technobliterator | well i could play but i don't know if oluap wants to |
| 12:23.27 | Irskaad | You can play as long as you don't whine when you get killed repeatedly |
| 12:23.30 | OluapPlayer | I can't play right now, mom might come in to clean the room at any moment |
| 12:23.35 | Irskaad | I didn't whine because it was normal when i was new |
| 12:23.37 | Irskaad | And kay |
| 12:24.34 | AdmiralPanda | Can people read this and give me some feedback? http://spore.wikia.com/wiki/User:Spriggs077/Ideas#Heroic_Sci-Fi |
| 12:25.01 | Technobliterator | i was gonna play with bots |
| 12:25.11 | Technobliterator | okaii Oluap pop up when yu're free |
| 12:35.51 | Monet | I looked at my roster and my El-Aurian is female and is a bartender. |
| 12:36.39 | Monet | Which means I have my own version of this lady http://images1.wikia.nocookie.net/__cb57886/memoryalpha/en/images/2/2f/Guinan_%282366%29.jpg |
| 12:38.52 | Jepardi | peep |
| 12:39.10 | Irskaad | inb4 Seldeen meeps |
| 12:40.44 | AdmiralPanda | Dum Hachi, get on already so someone will acculy read new fic segment |
| 12:43.40 | Monet | El-Aurians facinate me; they look human but Guinan herself is potentially 500 years old. |
| 12:45.10 | Monet | She spent some time on Earth in the 19th century. That is how old she is (at the very least). |
| 12:46.42 | Jepardi | peep |
| 12:46.54 | *** join/#sporewiki Zmr56 (5225ff69@gateway/web/qwebirc/irc.wikia.com/ip.82.37.255.105) |
| 12:47.01 | Zmr56 | Im back |
| 12:47.20 | Monet | The sad thing is, there are only a handful of El-Aurians left. |
| 12:48.56 | Seldeen | Meep |
| 12:49.02 | Monet | bbl |
| 12:51.54 | AdmiralPanda | Of course Angry Joe's mutant power would be a metal moustache :D |
| 12:53.36 | Zmr56 | What's everyone on about |
| 12:54.17 | Imperios | OluapPlayer |
| 12:54.24 | OluapPlayer | Imperios |
| 12:54.27 | Imperios | Do you know any DotA guides? |
| 12:54.31 | TechnoStarcraft | woooh!! go me:) |
| 12:54.38 | TechnoStarcraft | Imperios: dotacinema hur |
| 12:55.10 | Imperios | Thx |
| 12:55.59 | OluapPlayer | Imperios: http://www.playdota.com/guides/welcome-to-dota-you-suck |
| 12:56.56 | OluapPlayer | Technobliterator Imperios: http://www.youtube.com/watch?v=akUNmFAzS98 |
| 12:58.40 | Technobliterator | the "welcome to dota you suck didn't help me" |
| 12:59.47 | Irskaad | It doesn't right now, but when you start to understand, it helps much more |
| 13:00.40 | OluapPlayer | http://www.youtube.com/watch?annotation_id=annotation_708&feature=iv&src_vid=akUNmFAzS98&v=Wi01ChpR4sw |
| 13:01.59 | Zmr56 | What the heck is Dota :p |
| 13:03.30 | Technobliterator | OluapPlayer: cheers for the 4 minute tutorial even if i alread knew most of it:p |
| 13:03.50 | OluapPlayer | Check the 5 minute role guide |
| 13:09.49 | *** join/#sporewiki Technobliterator (56a8632b@gateway/web/freenode/ip.86.168.99.43) |
| 13:10.30 | *** join/#sporewiki Wormy (d92bf40d@gateway/web/freenode/ip.217.43.244.13) |
| 13:10.38 | Wormy | hello |
| 13:10.56 | Zmr56 | Worm worm wormy worm worm |
| 13:11.08 | Zmr56 | your theme ty |
| 13:11.18 | Zmr56 | u*tune |
| 13:11.33 | Wormy | k |
| 13:11.59 | Zmr56 | I will be doing that for a long time |
| 13:12.50 | Irskaad | eek a worm |
| 13:13.28 | Zmr56 | If you cut it in half it will come back alive |
| 13:14.31 | *** join/#sporewiki Xho (5ac81198@gateway/web/freenode/ip.90.200.17.152) |
| 13:14.43 | OluapPlayer | dat xho |
| 13:14.47 | Zmr56 | hello |
| 13:14.51 | Zmr56 | deemun |
| 13:14.58 | Wormy | Thats not actually true. |
| 13:15.02 | Wormy | hi |
| 13:15.03 | Xho | dat meemmann |
| 13:15.12 | Zmr56 | nwooo |
| 13:15.18 | Zmr56 | dat no true |
| 13:15.23 | Technobliterator | dum xho |
| 13:15.57 | Xho | dum u |
| 13:16.16 | Irskaad | Yay a deemun |
| 13:16.54 | Imperios | Irskaad: I wish I could have joined ya |
| 13:16.56 | Imperios | Hi Wormy |
| 13:17.02 | Imperios | Now Wormy and Irskaad |
| 13:17.03 | Imperios | #illarion |
| 13:17.12 | Wormy | The Asgard are as advanced as the DCP http://www.youtube.com/watch?v=cbZq2MPYHoY |
| 13:18.25 | Irskaad | You're so cute! :D |
| 13:20.48 | Imperios | Wormy #illarion |
| 13:20.58 | Zmr56 | And your so dwead! :D |
| 13:21.05 | Zmr56 | rawr |
| 13:21.37 | *** join/#sporewiki Catface (46f2a3db@gateway/web/freenode/ip.70.242.163.219) |
| 13:21.42 | Catface | Hi |
| 13:22.02 | Wormy | hi |
| 13:22.38 | Catface | Everyone sign up plox. If I get 5 people to use this referral I'll have a very high chance of getting in the beta http://www.waroftherosesthegame.com/?ref=dd0fa429b9c |
| 13:23.03 | Zmr56 | hola |
| 13:24.10 | Irskaad | Oh come on I already signed up for my Dota 2 friend |
| 13:24.27 | Irskaad | He asked the exact same thing |
| 13:26.29 | Catface | Well I'm a cool cat |
| 13:29.25 | Catface | Plus I have a manly taste in music. |
| 13:30.21 | Zmr56 | Imma cool dawg |
| 13:30.38 | Irskaad | puts cat near a fan of Justin Bieber, One Direction, Chemical Romance and Rebecca Black |
| 13:31.02 | Jepardi | peep |
| 13:31.13 | Catface | beats them to death while playing a megadeth song |
| 13:31.31 | Irskaad | is now happy |
| 13:32.32 | Imperios | makes a Justin Bieber music cannon |
| 13:32.36 | Imperios | fires it at Catface |
| 13:33.21 | Catface | Imperios: Can you do something for me? |
| 13:33.48 | Imperios | Ok |
| 13:33.54 | Imperios | What exactly? |
| 13:33.56 | Catface | Sign up for this http://www.waroftherosesthegame.com/?ref=dd0fa429b9c |
| 13:34.04 | Catface | I wanna get the beta :V |
| 13:34.43 | Imperios | I entered the link |
| 13:34.47 | Imperios | I have signed up right? |
| 13:35.12 | Catface | click "Click here to sign up" |
| 13:35.20 | *** join/#sporewiki darkscarypie (5455f616@gateway/web/qwebirc/irc.wikia.com/ip.84.85.246.22) |
| 13:35.34 | Irskaad | Hey dino |
| 13:35.42 | Catface | Hi |
| 13:35.58 | darkscarypie | hi |
| 13:36.13 | Zmr56 | who are you |
| 13:36.23 | Wormy | Hello |
| 13:36.25 | Zmr56 | dino? |
| 13:36.33 | darkscarypie | i was bronyboybro..but i closed my account |
| 13:36.33 | Zmr56 | eh |
| 13:36.53 | Irskaad | Oh |
| 13:36.55 | darkscarypie | my new youtube channel is:darkscarypie |
| 13:36.55 | Catface | Why did you do what? |
| 13:37.12 | darkscarypie | because i has nothing withmy channel |
| 13:37.41 | darkscarypie | ti created this video:http://www.youtube.com/watch?v=ZJFyi2SI0R0 i guess that it was a glitch hat i saw on spore GA |
| 13:38.47 | OluapPlayer | http://www.youtube.com/watch?v=QCAGwKDWZkE This is beautiful |
| 13:40.15 | Wormy | lol |
| 13:40.30 | Zmr56 | Can't hear it |
| 13:40.36 | Zmr56 | A movie is on |
| 13:41.15 | Zmr56 | All i heardvwas |
| 13:41.23 | Zmr56 | ppfffpppp |
| 13:41.41 | Zmr56 | or something like that |
| 13:41.55 | darkscarypie | i guess i saw on spore a sol glitch! XD |
| 13:43.30 | darkscarypie | i this a glitch? i wanna now! :3 shi shi! http://www.youtube.com/watch?v=ZJFyi2SI0R0 |
| 13:44.02 | Wormy | I don't think so |
| 13:44.36 | darkscarypie | oh |
| 13:44.54 | Catface | OluapPlayer: Moo http://www.waroftherosesthegame.com/?ref=dd0fa429b9c |
| 13:45.05 | darkscarypie | XD |
| 13:45.19 | Wormy | It looks like the orbits of Jupiter and Saturn entered a rare alignment |
| 13:46.46 | Imperios | Hi darkscarypie |
| 13:46.50 | Imperios | So you cook dark scary pies? |
| 13:46.58 | darkscarypie | nope.. |
| 13:47.18 | Zmr56 | who are you on the wiki |
| 13:48.06 | darkscarypie | nope.. |
| 13:48.17 | darkscarypie | i ont wanna e on the wiki anymore! |
| 13:48.30 | Zmr56 | why |
| 13:49.15 | darkscarypie | or im blocked again! |
| 13:49.39 | Zmr56 | what yoo do |
| 13:49.46 | Zmr56 | to get blocked |
| 13:50.19 | darkscarypie | then im mad |
| 13:53.15 | darkscarypie | oh i forgot to say:i allied with the grox..it was a dumb idea |
| 13:53.42 | Seldeen | GAIZ |
| 13:53.52 | Seldeen | WE HAVE TO FUND ANIMUSIC 3! |
| 13:53.57 | darkscarypie | so yeah..if you add me as buddy..lok out for my empire ok? |
| 13:54.24 | darkscarypie | i only want tobe friends with empires.. |
| 13:55.12 | Seldeen | Ppfffpppp |
| 13:55.25 | Wormy | ? |
| 13:55.38 | Seldeen | WE HAVE TO FUND ANIMUSIC 3! |
| 13:55.46 | Wormy | ?? |
| 13:55.49 | darkscarypie | what??? |
| 13:55.57 | Seldeen | Look up "ANIMUSIC |
| 13:55.57 | Zmr56 | wut |
| 13:56.04 | Seldeen | YOU WILL FALL IN LOVE |
| 13:56.15 | Seldeen | WITH THE ANIMATED MUSIC |
| 13:56.21 | Wormy | Love is overated |
| 13:57.00 | Zmr56 | I prefer friendship |
| 13:57.06 | Zmr56 | less complicated |
| 13:57.41 | R17 | and more magical |
| 13:57.43 | R17 | oops |
| 13:57.45 | R17 | forget what I just said |
| 13:57.49 | R17 | slaps himself |
| 13:58.11 | darkscarypie | if you wanna add me as buddy..my spore account=mike1265! |
| 13:58.12 | darkscarypie | :D |
| 14:01.30 | Jepardi | peep |
| 14:01.44 | Zmr56 | big |
| 14:01.48 | Zmr56 | tall |
| 14:01.52 | Zmr56 | pale |
| 14:01.57 | Zmr56 | faceless |
| 14:02.05 | Zmr56 | tuxedo |
| 14:02.18 | Zmr56 | =Slender |
| 14:02.35 | Jepardi | smacks Zmr56 |
| 14:03.14 | Zmr56 | kicks Jepardi |
| 14:03.40 | Jepardi | shoots Zmr56 in his legs |
| 14:04.09 | Zmr56 | vaporises Jepardi |
| 14:04.26 | Jepardi | haunts Zmr56 |
| 14:04.31 | Zmr56 | tou ded nao |
| 14:04.40 | Zmr56 | *you |
| 14:04.46 | Jepardi | No. |
| 14:05.03 | Jepardi | resurrects himself |
| 14:05.15 | darkscarypie | ?????????????????? what are ya guys doing?? |
| 14:05.19 | Zmr56 | cheata |
| 14:05.26 | Zmr56 | Epic fight |
| 14:05.27 | Jepardi | erases Zmr56 from universe |
| 14:05.54 | Zmr56 | makes his massive army in other univese |
| 14:06.15 | Zmr56 | and removes Jepardi from time |
| 14:06.17 | Jepardi | destroys that universe |
| 14:06.45 | Zmr56 | You ded me ded no one wins :p |
| 14:06.58 | Jepardi | resurrects himself |
| 14:07.09 | Jepardi | :trollface: |
| 14:07.27 | Zmr56 | No you removed feom time so you dont exsitence |
| 14:07.32 | Seldeen | Look up "ANIMUSIC". NOW! |
| 14:07.43 | Zmr56 | :trollface and rick roll |
| 14:08.02 | Catface | Seldeen: I will if you sign up for this http://www.waroftherosesthegame.com/?ref=dd0fa429b9c |
| 14:08.07 | Jepardi | erases Zmr56 from existence |
| 14:08.46 | Zmr56 | No you already removed from exsitence |
| 14:09.04 | Zmr56 | gets arceus |
| 14:09.18 | Zmr56 | Where your god nao? This maine |
| 14:09.42 | Zmr56 | Arceus use your POWAS |
| 14:10.58 | Zmr56 | Ooo...Some bond movie is on |
| 14:13.04 | Irskaad | INCOMING BARRAGE |
| 14:13.19 | Seldeen | What is it |
| 14:13.32 | Zmr56 | The bad guy remaunds me of cyrannian |
| 14:13.35 | Seldeen | AND ALSO, PLEDGE THE HIGHEST YOU CAN!!! |
| 14:14.08 | AdmiralPanda | holds up Irskaad as cover from the barrage |
| 14:14.09 | R17 | hmm... |
| 14:14.12 | *** join/#sporewiki Zmr56 (5225ff69@gateway/web/qwebirc/irc.wikia.com/ip.82.37.255.105) |
| 14:14.12 | R17 | "If a Dvottie gets killed by natural causes such as calamities, old age, diseases, a bad environment and the like, will that turn nature/the universe into a Dvottie?" |
| 14:14.16 | *** join/#sporewiki Monet (2ed0400f@gateway/web/qwebirc/irc.wikia.com/ip.46.208.64.15) |
| 14:14.20 | R17 | Dvotties are such... supernatural creatures... |
| 14:14.21 | Wormy | hi3 |
| 14:14.34 | AdmiralPanda | Probably not, because nature is not an entity |
| 14:14.39 | Zmr56 | dum irc |
| 14:14.50 | Monet | Hello. |
| 14:14.59 | Zmr56 | evil cat |
| 14:15.05 | Catface | Hi |
| 14:15.08 | Monet | Wha's this about dvotties and nature? |
| 14:15.16 | R17 | "If a Dvottie gets killed by natural causes such as calamities, old age, diseases, a bad environment and the like, will that turn nature/the universe into a Dvottie?" |
| 14:15.21 | Catface | Monet: Can I ask a favor of you? |
| 14:15.30 | R17 | Nature may not be an entity but I could still happen maybe... |
| 14:15.34 | AdmiralPanda | Assuming the disease is caused by an MO, the individual MO which causes the final strain on the Dvottie's system will become the dovttie |
| 14:15.37 | Zmr56 | oh i know what this is |
| 14:15.38 | AdmiralPanda | Dvottie* |
| 14:15.55 | AdmiralPanda | Age is just the Dvottie's body failing, so technically the Dvottie killed itself |
| 14:16.09 | AdmiralPanda | The same can be said about degenerative disease |
| 14:16.19 | AdmiralPanda | So most of those categories are already covered. |
| 14:16.21 | Monet | Catface: What is it? |
| 14:16.22 | Technobliterator | Catface: so what do i do with that signing thing? |
| 14:16.38 | R17 | and what about bad environment? Like... no atmosphere, or too much atmosphere? |
| 14:16.52 | AdmiralPanda | As for natural disasters, because it is not an entity killing the Dvottie, and the body taking over thing is only described as happening to entities, I'd say no |
| 14:16.55 | Zmr56 | wut this movie is already getting wierd |
| 14:16.55 | R17 | also: You do realize I'm not being serious right now right? |
| 14:17.07 | AdmiralPanda | When is anything involving Dvotties ever serious? |
| 14:17.23 | R17 | your attempt at making logical explanations IS serious. |
| 14:17.38 | Wormy | I'll be back in an hour or two |
| 14:17.44 | Zmr56 | bai |
| 14:17.56 | AdmiralPanda | Well duh, just because the topic isn't serious doesn't mean I can't approach the question in a logical manner |
| 14:18.04 | Zmr56 | true |
| 14:18.39 | R17 | Awww c'mon! That just ruins the humor! |
| 14:18.46 | R17 | if there was any, that is... |
| 14:18.50 | AdmiralPanda | There wasn't any humour to start with |
| 14:18.56 | R17 | I don't care |
| 14:19.16 | Technobliterator | dum Catface I can't help if you on't tell me what to do |
| 14:21.36 | Catface | Techo: Just click "Click here to sign up" |
| 14:21.45 | Zmr56 | god, this movie is wieed |
| 14:21.47 | Technobliterator | okay done |
| 14:21.49 | Technobliterator | now what |
| 14:21.59 | Catface | Fill out that one thing. |
| 14:22.13 | Catface | Monet: Sign up for this please http://www.waroftherosesthegame.com/?ref=dd0fa429b9c |
| 14:22.45 | Technobliterator | and press submit? |
| 14:23.01 | Catface | Yes. |
| 14:23.55 | Technobliterator | ...is that it? |
| 14:24.09 | Imperios | Hi |
| 14:24.39 | Catface | Yes |
| 14:24.46 | Technobliterator | Catface: okay so i signed up...oh i get it! |
| 14:25.25 | Irskaad | I swear I did this for FuckEveryoneImAUnicorn, my Dota 2 friend, about 2 weeks ago |
| 14:25.50 | *** join/#sporewiki GreatDestroyer12 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 14:26.23 | GreatDestroyer12 | who is darkscarypie |
| 14:27.49 | Technobliterator | idk |
| 14:29.01 | Monet | " If you get 5 friends to sign up using your referral URL, you will get guaranteed access to the beta." nice :P |
| 14:30.03 | Catface | Monet: You're a friend :V |
| 14:30.19 | Monet | True dat. |
| 14:30.39 | darkscarypie | i want have a powerful empire on spore! |
| 14:31.20 | GreatDestroyer12 | in the game or in fictionverse |
| 14:31.34 | Monet | Why am I suddenly thinking Darkscarypie watches MLP :P |
| 14:31.49 | Imperios | He DOES watch mlp |
| 14:32.01 | Imperios | His original nickname is Bronyboybro |
| 14:32.02 | Imperios | Wait |
| 14:32.04 | darkscarypie | n the game i want a powerful empire |
| 14:32.06 | Monet | That explains everything. |
| 14:32.06 | Imperios | Why did you thought that? |
| 14:32.16 | AdmiralPanda | He used to go by 'BronyBoyBro' |
| 14:32.20 | Technobliterator | Catface: i signed up too what bout me |
| 14:32.38 | darkscarypie | i like my little pony:vriendship is magic! |
| 14:32.44 | Monet | darkscary[pinky]pie |
| 14:32.46 | AdmiralPanda | Dum Impy ninja'd me while I was looking for his name :^ |
| 14:33.14 | Monet | AKA Pinkamena. |
| 14:33.31 | AdmiralPanda | Ugh y u remind me of that? |
| 14:33.31 | R17 | Pinkie* |
| 14:33.32 | darkscarypie | lol |
| 14:33.50 | Catface | Techno: Get your other friends to sign up for you. I can try to help you out if you want. |
| 14:33.51 | R17 | sorry for correcting Mon... umm... if that's okay with him... I guess... |
| 14:33.55 | darkscarypie | npe i only named ''darkscarypie'' |
| 14:34.06 | R17 | Pinkie not Pinky that is... |
| 14:34.09 | Catface | turns Monet and AdmiralPanda into cupcakes |
| 14:34.18 | Monet | Painis! |
| 14:34.31 | Imperios | Vriendship Is Magic |
| 14:34.35 | Technobliterator | Catface: nah i'm cool...i was just asing why am i not a friend if i signed up?:c |
| 14:34.37 | Imperios | VRIENDSHIP |
| 14:34.43 | AdmiralPanda | eats himself and turns back into a panda * |
| 14:34.51 | darkscarypie | im trying to make friends again in spore.. |
| 14:34.56 | Monet | I will eat you! |
| 14:35.00 | R17 | attempts to make a rainbow out of Catface. |
| 14:35.02 | Catface | Techno: You are more of a friend if you sign up |
| 14:35.11 | Technobliterator | i did |
| 14:35.12 | Technobliterator | :v |
| 14:35.13 | R17 | TELL ME I HAVE BEAUTIFUL EYES |
| 14:35.14 | R17 | jk |
| 14:35.19 | Catface | Then you are more of a friend. |
| 14:35.22 | Catface | :V |
| 14:35.23 | Technobliterator | :> |
| 14:35.26 | Monet | But yes, when I saw that 'pie' was in his name I immediately thought of Pinkie. |
| 14:35.36 | R17 | I see then. |
| 14:36.53 | R17 | Mon has at least a bit of knowledge 'bout ponies, but I doubt he'd be joining the herd. Right? |
| 14:37.03 | Catface | Monet: I did too. |
| 14:37.22 | Imperios | sAME THOUGHT |
| 14:37.23 | Monet | R17: I won't be. |
| 14:37.29 | Imperios | Pinkie can be both dark and scary |
| 14:37.32 | Imperios | Especially in fanon |
| 14:37.40 | R17 | Mon: INdeed |
| 14:37.44 | R17 | Indeed* |
| 14:37.48 | darkscarypie | are you guys talking about me!?! |
| 14:37.53 | Monet | I only know about her in name and that she's one of the more major characters. |
| 14:38.18 | Imperios | Imagine Irskaad as a pony |
| 14:38.37 | Imperios | Here you go, Pinkie Pie |
| 14:38.43 | AdmiralPanda | Irskaad doesn't love and tolerate though |
| 14:38.44 | Imperios | Okay, Irskaad with a bit of Dino and Xho |
| 14:38.46 | R17 | I don't want to think about or see grimdark ponies right now. |
| 14:38.50 | Technobliterator | Catface: this douchebag on my fb was going all "when music hits you feel no pain - drake <33" and then when told that it actually came from bob marely they didn't believe it.. |
| 14:39.52 | darkscarypie | guys stop talking about me ok?? |
| 14:39.56 | AdmiralPanda | Money: best description of Pinkie Pie: 50% Asgord, 50% party |
| 14:40.15 | AdmiralPanda | darkscarypie: Shup. You said it yourself you want nothing to do with the wiki, so what are you even doing here? |
| 14:40.20 | Irskaad | I just realized I'm a mix between Dinoman and Xho - I can act like each depending on my mood |
| 14:40.25 | Technobliterator | who is darkscarypie? |
| 14:40.26 | Monet | http://www.youtube.com/watch?v=9ACWbrqkPdQ&feature=g-vrec let's stop thinking of ponies and enjoy the good old days. |
| 14:40.39 | darkscarypie | :3 |
| 14:40.42 | Technobliterator | lol irsk |
| 14:40.50 | Xho | You're still nothing like me at all |
| 14:40.56 | AdmiralPanda | ^ |
| 14:41.02 | Irskaad | y not i can be meen too |
| 14:41.14 | Technobliterator | i dunno who darkscarypie is but i do know that you guys shouldn't be all mean |
| 14:41.19 | Technobliterator | Irskaad: cus u dum asgord |
| 14:41.37 | Irskaad | I don't act Asgordian when annoyed |
| 14:41.57 | Technobliterator | true |
| 14:42.02 | Monet | Irskaad doesn't get Xho-angry. |
| 14:42.04 | Irskaad | wishes he could sell his TF2 items so he can buy more Dota items |
| 14:42.21 | Monet | Sell your hats, are you mad? |
| 14:42.26 | AdmiralPanda | Lol |
| 14:42.31 | Irskaad | Yeah |
| 14:42.38 | Irskaad | For Dota hats :3 |
| 14:43.34 | darkscarypie | oh and yes... |
| 14:43.58 | darkscarypie | i have 104 colonys on my empire |
| 14:44.21 | AdmiralPanda | Well I'm off |
| 14:44.39 | Monet | Okay. |
| 14:44.41 | AdmiralPanda | If Hachi comes on, tell him to have a look at the latest section on my fic. I'll send him a link |
| 14:44.58 | R17 | on a side note: http://i.imgur.com/3SFio.png Here's a quick, not-so-good attempt at 5 Xarik-Radux figures of infamy as represented by stickmen. |
| 14:46.09 | AdmiralPanda | Now excuse me while I kick the crap out of a Tahar before I go |
| 14:46.34 | Monet | I'm thinking of calling a meeting between AGC members in the next few days. |
| 14:46.40 | AdmiralPanda | proceeds to kick the crap out of a Tahar in front of Irskaad * |
| 14:46.40 | Irskaad | Tahar - ?! |
| 14:46.54 | Irskaad | My poor Tahie :_( |
| 14:47.05 | AdmiralPanda | Monet: I assume that means ACTUAL AGC members not allies |
| 14:47.15 | *** join/#sporewiki Technobliterator (1f356485@gateway/web/freenode/ip.31.53.100.133) |
| 14:47.26 | Technobliterator | dum |
| 14:47.32 | Monet | AP: Corrrect |
| 14:47.36 | AdmiralPanda | You missed me kick the crap out of a Tahar |
| 14:47.37 | Jepardi | http://www.youtube.com/watch?v=BLphfppRIaU&feature=fvwrel |
| 14:47.46 | AdmiralPanda | Monet: Good, I don't have to be there :3 |
| 14:48.32 | Irskaad | http://www.dota2wiki.com/wiki/Timebreaker Currently the rarest item in Dota 2 |
| 14:48.35 | Monet | It's a meeting of the Androemdan Light wich so that would include Liquid, Bio21, Xho, Imperios and LotG. |
| 14:48.52 | Irskaad | Warning: Picture does not correspond to the new model that was released this patch |
| 14:49.28 | Monet | And me. |
| 14:50.04 | Irskaad | http://www.dota2wiki.com/images/4/4d/Timebreaker.png This is the new model |
| 14:51.22 | Monet | Erm, irskaad old buddy: I am seeing the exact same weapon. |
| 14:51.33 | Irskaad | Wha but the page is showing the old one |
| 14:51.42 | Monet | Not for me. |
| 14:51.52 | Catface | Irsk is growing senile in his old age. |
| 14:51.56 | Monet | What does the old oen look like? |
| 14:52.06 | Irskaad | wat da hell *Throws his USB internet connection through the window* |
| 14:52.23 | Irskaad | http://www.dota2wiki.com/images/archive/4/4d/20120810005853!Timebreaker.png |
| 14:52.58 | Irskaad | It was a ripoff from Aion that a user made |
| 14:53.12 | Irskaad | The community was all "RAGE RIPOFF" and Valve fixed it |
| 14:53.19 | Monet | It looks very different. |
| 14:53.28 | Irskaad | Exactly |
| 14:53.43 | Irskaad | Now the Timebreaker is the rarest item in Dota 2 |
| 14:54.18 | Monet | It may be reare but is it any better than the base item? |
| 14:54.40 | Irskaad | erm wha |
| 14:55.42 | Monet | Is it any better than waht he start with? |
| 14:56.58 | Monet | if not then meh. |
| 14:57.15 | Technobliterator | doesn't get what you're asking |
| 14:57.38 | Irskaad | ^ |
| 14:58.00 | Monet | .... Is it a good weapon? |
| 14:58.21 | Catface | He is asking if it is any better than the default weapon or does it just look nice |
| 14:58.24 | Irskaad | ...It's just a cosmetic item |
| 14:58.27 | Xho | dum |
| 14:58.42 | Monet | Irskaad: That's what I thought. |
| 14:58.45 | Technobliterator | All Dota 2 store weapons are cosmetic |
| 14:58.58 | Irskaad | ^^^^^^^^ |
| 14:59.02 | Catface | Xho: Sign up for this and you wil lbecome a bass god http://www.waroftherosesthegame.com/?ref=dd0fa429b9c |
| 14:59.27 | Monet | When it comes to gear I'm only interested in the rare stuff if it is any good. |
| 15:00.13 | Xho | nein |
| 15:00.42 | Monet | I generally only use a cool-looking weapons for RP purposes. It's a WoW thing. |
| 15:00.53 | Xho | Signed up |
| 15:00.56 | Xho | Regrettably |
| 15:01.19 | Catface | Your bass god member card will be in the mail shortly. |
| 15:06.49 | TechnoStarcraft | test |
| 15:07.28 | Catface | Passed by a hair |
| 15:07.40 | Xho | So you got the beta? |
| 15:08.30 | Catface | I'm pretty sure. |
| 15:08.31 | Irskaad | uses a whiff of science, and then a dash of common sense on a Xhodocto |
| 15:09.08 | Catface | So I'll get to stab people in the face like seen at the start of this video www.youtube.com/watch?v=9RwSJH1POwc |
| 15:10.05 | Xho | It's funny cause i'm not going to give you a civilized response any time soon |
| 15:10.16 | Irskaad | 3: |
| 15:10.26 | Irskaad | y not |
| 15:10.44 | Xho | I have many reasons which could get me in trouble if I mentioned them |
| 15:11.05 | Catface | I'm sure if you ever met Xho he would stab you in the face like that one guy in the video I posted. |
| 15:14.31 | Catface | test |
| 15:15.11 | Xho | Aye |
| 15:25.10 | Irskaad | eek a jo |
| 15:25.20 | Technobliterator | Xho/Catface: I have a question for you both |
| 15:25.33 | Technobliterator | If you could kill either justin bieber or nicki minaj, who would you kill |
| 15:26.39 | Xho | Too difficult a question |
| 15:27.33 | Technobliterator | hur |
| 15:28.07 | Catface | Nicki Minaj |
| 15:29.34 | Technobliterator | i c |
| 15:30.13 | R17_DoW | I would kill Bieber |
| 15:31.00 | R17_DoW | I barely know who Nicki Minaj is other than the fact that I've known of her song "Super Bass" |
| 15:31.11 | R17_DoW | and that she voiced a character in Ice Age 4 |
| 15:31.18 | Technobliterator | i like Super Bass |
| 15:31.28 | Monet | Nicki Minaj sings like she's not even trying. |
| 15:31.41 | Monet | Its that bad. |
| 15:31.46 | Technobliterator | well tbh i like some her songs, her image is a bit fake, and i hate lil wayne |
| 15:31.57 | Technobliterator | it's true monet |
| 15:32.07 | R17_DoW | and my cursor is weird right now |
| 15:32.11 | Technobliterator | lool |
| 15:32.26 | R17_DoW | let me demonstrate |
| 15:32.28 | Technobliterator | girls love nicki because they like her songs |
| 15:32.34 | Technobliterator | boys love her because she has a big ass |
| 15:32.45 | Irskaad | LOL |
| 15:32.49 | R17 | wait |
| 15:32.50 | R17 | damn |
| 15:32.51 | Technobliterator | it's true:p |
| 15:33.00 | R17 | wtf why does printscreen not show cursor |
| 15:33.10 | Technobliterator | printscreen never shows the mouse |
| 15:33.12 | Technobliterator | iirc |
| 15:33.24 | R17 | damn |
| 15:33.35 | R17 | I was gonna' demonstrate what my cursor looks like right now |
| 15:33.43 | R17 | but let's just say it looks like a Golgi body. |
| 15:33.46 | Technobliterator | lol |
| 15:34.47 | R17 | gtg sleep bye |
| 15:49.02 | Irskaad | Yay Ko |
| 15:50.21 | Catface | Hi friend |
| 15:50.40 | Impaway | Sup |
| 15:51.22 | OluapPlayer | hi |
| 16:01.12 | Monet | I was reading up on noblegases and I wonder, ligtning as we all know is blue right? |
| 16:01.29 | Irskaad | It's white AFAIK |
| 16:01.51 | Monet | whitey-blue then. |
| 16:01.59 | Technobliterator | OluapPlayer: can we play dota? |
| 16:02.07 | Catface | Nope |
| 16:02.12 | OluapPlayer | Just a minute |
| 16:02.16 | OluapPlayer | or 5 |
| 16:02.21 | Technobliterator | okaii |
| 16:04.14 | Impaway | Monet: In WoW I was a priest :> |
| 16:04.18 | Impaway | Oops |
| 16:04.23 | Impaway | Ah |
| 16:04.23 | Monet | So I wondered. It is most-likely that lightning's colour comes from trace amounts of argon in our atmophere (argon give off a blue light when an electrical current passes through it). If that's so would lightning on a planet with trace levels of neon instead of Argon have orange lightning? |
| 16:04.37 | Impaway | I had no need for cool weapons |
| 16:04.39 | Impaway | Just a cool dress |
| 16:04.42 | Impaway | Monet: Hm |
| 16:04.45 | Impaway | Yeah |
| 16:04.50 | Impaway | Orange lightning is pretty cool |
| 16:05.56 | OluapPlayer | Alright let's play now |
| 16:09.51 | Monet | Drat. Neither Spriggs, Ghelae or Wormy are here to say if I am on the right lines or not. |
| 16:10.18 | Impaway | Drat |
| 16:10.19 | Impaway | :> |
| 16:10.24 | Impaway | I like dat insult |
| 16:13.09 | Monet | http://www.webexhibits.org/causesofcolor/4.html accoding to this I am close. |
| 16:13.52 | Monet | Lightning itself is whitel as irskaad said, because of EM emissions i nthe visible spectrum causing the main channel to glow white-hot. |
| 16:13.56 | *** join/#sporewiki Atamolos (adaf3493@gateway/web/qwebirc/irc.wikia.com/ip.173.175.52.147) |
| 16:14.16 | Irskaad | eek a bio |
| 16:14.24 | Monet | Hello. |
| 16:14.57 | Atamolos | engulfs Irskaad in a dark matter sphere and compresses him down to the size of an electron. |
| 16:15.31 | Irskaad | dies |
| 16:15.33 | Monet | Don't mind me I'm trying to work out what colour-lighting a mix of neon and nitrogen would create. |
| 16:16.12 | Monet | Since one of the lpanets I have come up with has small amounts of neon in its atmosphere instead of argon. |
| 16:16.20 | *** join/#sporewiki Wormy (d92bf40d@gateway/web/freenode/ip.217.43.244.13) |
| 16:16.41 | Monet | Hello. |
| 16:16.51 | Wormy | hi |
| 16:16.52 | Atamolos | hi |
| 16:17.41 | Monet | ~see nCyrannian |
| 16:17.42 | infobot | ACTION whispers to nCyrannian "You didn't see anything...." |
| 16:17.55 | Monet | ~seen Cyrannian |
| 16:17.58 | infobot | cyrannian <562f4dfc@gateway/web/freenode/ip.86.47.77.252> was last seen on IRC in channel #sporewiki, 14h 54m 51s ago, saying: 'Bye!'. |
| 16:18.50 | *** join/#sporewiki Hachi_ (56938583@gateway/web/freenode/ip.86.147.133.131) |
| 16:18.51 | Hachi_ | dum |
| 16:19.22 | Atamolos | no u dum |
| 16:19.23 | Wormy | ~Return Ghelae |
| 16:19.40 | Wormy | ~Bring back Ghelae |
| 16:20.03 | Irskaad | ~Xhoddie |
| 16:21.51 | Impaway | Hi wabbit |
| 16:22.48 | Hachi_ | http://lotg.deviantart.com/art/Foshi-Exodus-Form-320389199 Foshi's Exodus Form |
| 16:22.53 | Hachi_ | I had it finished last night |
| 16:23.06 | Irskaad | I saw :333333333333333333333333 |
| 16:23.48 | Monet | Wormy: I have a scienc-y question: is it possible that an atmosphere of oxygen, nitrogen and neon could ceraate orange lightning? |
| 16:25.36 | Wormy | I'm not sure, but the colour of lightning is determined by things like elements in the air, and other things |
| 16:26.44 | Wormy | Though since lightning does appear in a sheer variety of colours due to all sorts of reasons (moisture, dust, distance), orange lightning might not be the only colour to appear |
| 16:27.36 | *** join/#sporewiki Cyrannian (562f1f7c@gateway/web/freenode/ip.86.47.31.124) |
| 16:27.36 | *** mode/#sporewiki [+o Cyrannian] by ChanServ |
| 16:27.52 | Impaway | Sup |
| 16:28.00 | Monet | It was a thought since to some, seeing orange lightning could reinfoce the idea that yo're on an 'alien' planet. |
| 16:28.02 | Monet | Hello. |
| 16:28.07 | Irskaad | ANTEDDY |
| 16:28.10 | Wormy | Nitrogen creates the typical white-blue lightning though |
| 16:28.14 | Cyrannian | Hello! |
| 16:28.19 | Wormy | Hi |
| 16:28.29 | Cyrannian | I hate it when blogs I created in 2010 gain activity again |
| 16:28.36 | Monet | I still want to make the planet's atmosphere breatheable. |
| 16:29.17 | Monet | Cyrannian: Somehow the newer players seem to randomly find them and dig tthem up. |
| 16:29.25 | Monet | newer users, rather. |
| 16:30.02 | Cyrannian | Mmhm, I think there is a list of blogs somewhere. That's probably where they get them. |
| 16:30.55 | Monet | Or they go hunting through userpages. |
| 16:32.03 | Monet | Anyway, I ahd an idea for a possible logo for the Gigaquadrantic council similar to the logo of the UFP (which i believe was based in turn on the UN's emblam). |
| 16:33.10 | Cyrannian | I don't think it needs a logo. It's not an organisation, as such. |
| 16:33.54 | Monet | I suppose. |
| 16:34.37 | Monet | I still feel like making one anyway, it might be nice to go on my DA profile. |
| 16:35.15 | Seldeen | RATATATAATATTATACGCGCGAGAGCTGACGATGTACGTGTGATGAGGAGCGTA |
| 16:35.40 | Irskaad | PPAPASCATAG |
| 16:35.48 | Hachi_ | Spam much? |
| 16:35.52 | Cyrannian | Yesterday was fun. |
| 16:36.19 | Irskaad | Bloodseeker was fun. |
| 16:37.08 | Monet | I cannto remember what started the entire thing apart from me showing off. |
| 16:37.22 | Hachi_ | Next up, I gotta do Foshi's Reset Form. |
| 16:37.45 | Hachi_ | Which is basically a coccoon |
| 16:37.57 | Irskaad | Genesis form + 1? |
| 16:37.59 | Monet | I posted a picture of me at a world record event but I cannot remember what reminded me of the event. |
| 16:38.17 | *** join/#sporewiki Catface (46f2a3db@gateway/web/freenode/ip.70.242.163.219) |
| 16:38.27 | Monet | In other words after a certain amount of time the whole cycle starts again. |
| 16:38.33 | Hachi_ | No, Reset Form gives all the energy Foshi absorbed back throughout the Universe |
| 16:38.41 | Hachi_ | Yeah Monet's right |
| 16:39.21 | Irskaad | How does Reset form happen? |
| 16:39.22 | Hachi_ | Genesis Form either uses all its energy and dies, or Exodus Form decides to destroy itself, and it reverts to a cocoon stage, where all the energy shi absorbed is returned |
| 16:39.32 | Irskaad | Oh |
| 16:40.09 | Monet | conservation of energy states that energy has to go somewhere, so Foshi releases it back int othe universe. |
| 16:40.30 | Hachi_ | After a long period of being in a cocoon, Foshi emerges in hir baby form again |
| 16:40.31 | Monet | First law fo thermodynamics. |
| 16:40.38 | Monet | of* |
| 16:42.48 | Wormy | I need some punctual help regarding apostrophies. |
| 16:43.06 | Wormy | Sometimes, thats is that's, and sometimes that's is thats |
| 16:43.27 | Wormy | In what context do I use both? |
| 16:43.48 | Atamolos | I'm back. |
| 16:44.24 | Cyrannian | http://a3.sphotos.ak.fbcdn.net/hphotos-ak-ash4/378346_505446816151443_140129589_n.jpg |
| 16:44.39 | Wormy | Lol seen |
| 16:44.48 | Catface | I bet you geeked out over that one, Um. |
| 16:44.59 | Irskaad | Anything Dota related in that website, cyrie? |
| 16:45.33 | Cyrannian | I doubt it |
| 16:45.45 | Catface | Wormy: Do you have the time and reason? |
| 16:45.55 | Cyrannian | http://a8.sphotos.ak.fbcdn.net/hphotos-ak-snc6/268687_453226568031245_604577281_n.jpg |
| 16:46.07 | Wormy | The here and why and what now? |
| 16:47.04 | Cyrannian | http://a2.sphotos.ak.fbcdn.net/hphotos-ak-ash4/394459_504550176241107_36232248_n.jpg |
| 16:47.08 | Catface | I wanna talk about our Slenderman stuff. |
| 16:47.44 | Wormy | Ah okay |
| 16:52.15 | Cyrannian | http://a4.sphotos.ak.fbcdn.net/hphotos-ak-ash3/547841_500616216634503_138132600_n.jpg |
| 16:52.37 | Wormy | lol |
| 16:53.47 | Cyrannian | http://a4.sphotos.ak.fbcdn.net/hphotos-ak-prn1/555042_499247710104687_454532440_n.jpg |
| 16:54.43 | Hachi_ | lol |
| 16:55.38 | Cyrannian | http://a5.sphotos.ak.fbcdn.net/hphotos-ak-ash4/255321_490689700960488_220088265_n.jpg |
| 16:56.06 | *** join/#sporewiki Catface (46f2a3db@gateway/web/freenode/ip.70.242.163.219) |
| 16:56.16 | Irskaad | Capastrus in a nutshell |
| 16:57.52 | Monet | XD |
| 16:59.30 | OluapPlaying | hur me and Jo playing |
| 16:59.40 | OluapPlaying | She got 1-7 and I got 16-0 |
| 16:59.53 | *** join/#sporewiki TheBuilder (ba30086c@gateway/web/qwebirc/irc.wikia.com/ip.186.48.8.108) |
| 17:00.00 | Cyrannian | http://a4.sphotos.ak.fbcdn.net/hphotos-ak-snc7/409519_359930040703122_945704518_n.jpg |
| 17:00.04 | Cyrannian | ~glomp OluapPlaying |
| 17:00.04 | infobot | ACTION becomes fully animated as her eyes squint in an upside-down-U formation, gets a running start and tackle-glomps OluapPlaying |
| 17:00.05 | Irskaad | Was it in a co-op or pub? |
| 17:00.15 | OluapPlaying | Me+her+bots |
| 17:00.28 | OluapPlaying | ~smash Cyrannian |
| 17:00.28 | infobot | ACTION flings an anvil in Cyrannian's general direction |
| 17:00.31 | Irskaad | Oh, 1v1 or 2vbots? |
| 17:00.41 | OluapPlaying | 2vbots |
| 17:00.48 | OluapPlaying | I was Slardar and she was Zeus |
| 17:00.54 | Irskaad | DAMMIT Y U NO MONDAY |
| 17:02.34 | Imperios | Hi |
| 17:02.39 | Imperios | I wish I could join you |
| 17:03.11 | *** join/#sporewiki DrodoEmpire (8e44b7b0@gateway/web/freenode/ip.142.68.183.176) |
| 17:03.25 | DrodoEmpire | Hey everybody! |
| 17:04.07 | Imperios | Wormy: How does Cathemeran surface look like? |
| 17:04.13 | Imperios | Is it flat mostly? |
| 17:04.23 | Imperios | And how does its sun look like |
| 17:04.58 | Monet | The sun is a white dwarf. |
| 17:05.11 | Wormy | I'd imagine it is flat, with what little of its atmosphere left frozen to the ground. The ice will be extremely dirty, covered in dust and organic molecules. |
| 17:05.26 | Wormy | Like in the Outer Solar System |
| 17:05.37 | *** join/#sporewiki Jepardi (d4e22b83@gateway/web/freenode/ip.212.226.43.131) |
| 17:05.47 | Jepardi | Hi |
| 17:05.58 | Wormy | Imperios: Some dust will actually be suspended off the ground due to electrostatic effects |
| 17:06.22 | Wormy | Remember that the planet is bigger than its Sun |
| 17:06.50 | Wormy | hi |
| 17:06.51 | DrodoEmpire | So, its star is orbiting the planet? |
| 17:07.06 | Wormy | The star is a white dwarf |
| 17:07.15 | DrodoEmpire | I see, |
| 17:07.20 | Monet | Tiny embers of starlight. |
| 17:07.42 | Wormy | The planet, Cathemera was a gas giant which lost most of it's atmosphere but retains a planetary core |
| 17:08.02 | Imperios | So it gonna be somewhat cold? |
| 17:08.13 | Wormy | Ver, very cold |
| 17:08.31 | DrodoEmpire | Bring a jacket! |
| 17:08.35 | DrodoEmpire | :3 |
| 17:08.45 | Wormy | And a scarf |
| 17:08.47 | Monet | It would only be a few degrees above aboslute zero right? |
| 17:08.50 | DrodoEmpire | Ya, |
| 17:09.04 | Wormy | Possibly |
| 17:09.22 | Imperios | OluapPlaying: I have a question |
| 17:09.33 | OluapPlaying | wat |
| 17:09.35 | Imperios | What is the easiest summoner hero to play? |
| 17:09.39 | Imperios | In DotA |
| 17:09.46 | OluapPlayer | Summoner in what way? |
| 17:09.53 | OluapPlayer | Summoning minions to help? |
| 17:09.54 | Imperios | Like Ench |
| 17:09.57 | Imperios | Or Enigma |
| 17:09.58 | Imperios | Yeah |
| 17:10.02 | OluapPlayer | Hm |
| 17:10.03 | OluapPlayer | Warlock |
| 17:10.05 | Imperios | Thx |
| 17:10.27 | Monet | http://images1.wikia.nocookie.net/spore/images/4/46/1stGig_CouncilemblamBeta.png we could always use this for Halcyon. |
| 17:10.40 | OluapPlayer | His ultimate summons a golem demon thing |
| 17:10.45 | Imperios | It's a pity that I like Enchantress so much., because she is apparently a hard hero to play |
| 17:10.51 | OluapPlayer | She is |
| 17:10.52 | Monet | Anyt thoughts on the image? |
| 17:10.55 | OluapPlayer | She's a carry |
| 17:11.04 | OluapPlayer | It's good, monet |
| 17:11.16 | Technobliterator | i'm still playing hur |
| 17:11.20 | Technobliterator | but i so lonely |
| 17:11.38 | Imperios | Okay |
| 17:11.39 | Imperios | Hm |
| 17:11.49 | Imperios | Is there any easy to play Jungler OP? |
| 17:12.48 | Technobliterator | playing as sven this time |
| 17:12.58 | Technobliterator | irsk spectate |
| 17:12.59 | Technobliterator | :v |
| 17:13.09 | OluapPlayer | Jungler? |
| 17:13.10 | OluapPlayer | Lemme see |
| 17:14.16 | OluapPlayer | Bloodseeker, Ursa and Lycan |
| 17:14.26 | Monet | I'll be back alter |
| 17:14.32 | Irskaad | Jo: Fien |
| 17:14.38 | Imperios | I thought you said Ursa is hard cuz he's a carry |
| 17:14.42 | Irskaad | But I can barely watch cuz lag |
| 17:15.38 | Imperios | But I heard Ursa could defeat Roshan in a one-to-one battle |
| 17:15.41 | Imperios | Which is kinda good |
| 17:15.48 | OluapPlayer | And he can |
| 17:15.53 | Irskaad | "Update Required" I'll try to update now |
| 17:16.00 | OluapPlayer | he's a carry but he's one of the simplest |
| 17:16.26 | Irskaad | I thought Skelly King was baby's first carry |
| 17:16.33 | OluapPlayer | "one of" |
| 17:16.39 | Imperios | So I will play an Ursa |
| 17:16.43 | Imperios | He looks cool as well |
| 17:16.48 | Imperios | Ursa Major :> |
| 17:17.45 | Wormy | Hur if you tried to picture Graham's number in your head there would be so much information you would collapse into a black hole http://www.youtube.com/watch?v=XTeJ64KD5cg&feature=relmfu |
| 17:18.53 | Seldeen | Jello! I'm back! |
| 17:19.08 | Seldeen | IRSKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD |
| 17:19.13 | Seldeen | :"D |
| 17:19.47 | Irskaad | SELDEEEEEEEEEEEEEEEEEEN |
| 17:20.06 | Technobliterator | i got bored of playing on my own |
| 17:20.08 | Technobliterator | so i left game |
| 17:20.09 | Technobliterator | :v |
| 17:20.52 | Irskaad | 3: |
| 17:20.58 | Seldeen | QHUME |
| 17:21.06 | Irskaad | EHOME |
| 17:21.13 | OluapPlayer | hur |
| 17:21.27 | Irskaad | Did you get the reference, Ko? |
| 17:21.37 | Wormy | Monet tried to picture Graham's number. |
| 17:21.42 | OluapPlayer | No |
| 17:21.53 | Irskaad | dum i thought you did |
| 17:22.02 | Irskaad | EHOME is a pro Dota 2 team |
| 17:22.25 | OluapPlayer | I don't care for pro teams |
| 17:22.31 | Technobliterator | http://en.wikipedia.org/wiki/Blonde_stereotype dum dis is me |
| 17:22.38 | Irskaad | y not dey awesum |
| 17:22.40 | OluapPlayer | hur |
| 17:23.02 | Irskaad | Jo, you're way smarter than a stereotypical blonde |
| 17:23.10 | Irskaad | iJustine is a stereotypical blonde |
| 17:23.12 | Technobliterator | awww cheers |
| 17:23.15 | Technobliterator | :) |
| 17:23.35 | OluapPlayer | no yor a perfekt exampel of a dum blond ya dum blond |
| 17:23.38 | Irskaad | iJustine - *On one of the easiest puzzles in the game* I DON'T GET IT |
| 17:24.34 | Technobliterator | shup oluap yor a dum...brazillian ya dum brazillian |
| 17:25.29 | Seldeen | :"D Kolluaaaaaaaap |
| 17:25.39 | Seldeen | :"D Waaaaaaaaaaaaaaptoooooooooooooor |
| 17:26.01 | Seldeen | :"D EEEEEEEEEEEEEEEEEEEEEVERYOOOOOOOOOOONE ON! |
| 17:26.11 | Seldeen | HI Y'ALL! |
| 17:26.19 | OluapPlayer | http://www.youtube.com/watch?feature=player_embedded&v=S_UacKL0TQw dam |
| 17:26.29 | Seldeen | fiuff |
| 17:26.37 | Irskaad | puts Seldeen in Portugal - "See? No longer in the US :>" |
| 17:27.44 | Technobliterator | OluapPlayer: omgwtf |
| 17:28.01 | Technobliterator | ewww.. |
| 17:28.44 | OluapPlayer | http://www.dota2wiki.com/images/f/f1/Necr_laugh_07.mp3 |
| 17:29.54 | Cyrannian | I'll be on STO |
| 17:32.48 | Seldeen | nup |
| 17:33.36 | Seldeen | NSRO |
| 17:33.37 | Seldeen | EHIOFAD |
| 17:33.38 | Seldeen | PFOUFISK |
| 17:33.46 | Seldeen | BURRMOUMPRUMP |
| 17:33.57 | Seldeen | Irskaad: #nidlak-arkil |
| 17:34.23 | *** join/#sporewiki Technobliterator (56974397@gateway/web/freenode/ip.86.151.67.151) |
| 17:34.36 | Catface | Mama |
| 17:35.08 | Seldeen | Papa! |
| 17:35.15 | OluapPlayer | Stop with the random messages |
| 17:35.29 | Seldeen | Ohlol |
| 17:35.31 | Seldeen | Fien |
| 17:36.24 | Seldeen | :Incoming Messages to SporeWiki from Needles_10- Make Pre-Recorded Messages Instead: |
| 17:40.02 | Technobliterator | http://www.rockerssoft.org/brockers/Documents/xbox-controller-ps2.jpg hur |
| 17:40.45 | Irskaad | huuuuuuuuuuuge |
| 17:41.54 | Technobliterator | yep |
| 17:42.01 | DrodoEmpire | You know, |
| 17:42.03 | Technobliterator | xbox 1 controlled was garbage |
| 17:42.22 | DrodoEmpire | If they threw a bit more money at making the controller, |
| 17:42.40 | DrodoEmpire | they could of made its own portable gaming system. |
| 17:42.52 | DrodoEmpire | Its certainly large enough. |
| 17:43.27 | Technobliterator | the future of games is in the cloud anyway |
| 17:43.31 | DrodoEmpire | Ya, |
| 17:43.37 | Technobliterator | maybe we wn't see console anymore by a few years time. |
| 17:44.02 | DrodoEmpire | Maybe, |
| 17:44.15 | *** join/#sporewiki Monet (2ed0400f@gateway/web/qwebirc/irc.wikia.com/ip.46.208.64.15) |
| 17:44.20 | Catface | Techno: Stop having your head in the clouds :V |
| 17:44.22 | Monet | Hello |
| 17:44.26 | DrodoEmpire | Hello, |
| 17:44.28 | Technobliterator | hi monet |
| 17:44.36 | Technobliterator | Catface: shup dis the truth |
| 17:44.49 | Technobliterator | If you ever saw a Gaikai demo you'd know what I mean |
| 17:44.50 | DrodoEmpire | But microsoft isn't done humping the leg of the Xbox consoles, |
| 17:45.02 | Technobliterator | microsoft can go fuck bill gates up the ass |
| 17:45.04 | Technobliterator | i hate em |
| 17:45.16 | DrodoEmpire | So I think they'll be kicking around for a little while. |
| 17:45.33 | DrodoEmpire | I like windows OS systems a lot better, |
| 17:46.01 | DrodoEmpire | although Apple has some kick-ass portables |
| 17:46.23 | Technobliterator | really? |
| 17:46.32 | DrodoEmpire | What do you mean? |
| 17:46.35 | Technobliterator | Mac OS X and Linux both own Windows |
| 17:46.47 | DrodoEmpire | I just like Windows, |
| 17:46.49 | Catface | I don't like Mac |
| 17:46.57 | DrodoEmpire | I don't see the problem. |
| 17:47.03 | Technobliterator | Windows is only popular because Microsoft pay people to own them and because of the software on Windows |
| 17:47.11 | DrodoEmpire | Meh, |
| 17:47.13 | Catface | Linux controls the missles so we don't talk about it. |
| 17:47.17 | DrodoEmpire | I grew up with it. |
| 17:47.17 | Technobliterator | But you can justget an emulator for Linux or Mac to run Windows software anyway |
| 17:47.20 | Technobliterator | lol cat |
| 17:47.26 | Catface | Macs are overpriced imo. |
| 17:47.32 | Technobliterator | i wn't argue there |
| 17:47.50 | Technobliterator | but i just hate microsoft |
| 17:48.05 | Technobliterator | They pop up in randm markets with unoriginality just to say "moov ova we want moar dosh" |
| 17:48.07 | Irskaad | Windows 8 is a disaster |
| 17:48.26 | DrodoEmpire | I had a bad feeling about it, |
| 17:48.35 | Technobliterator | They robbed Mac OS and made Windows thne tripled the profits by being douchebags |
| 17:48.35 | DrodoEmpire | how is it, exactly? |
| 17:48.45 | DrodoEmpire | I see, |
| 17:48.56 | Monet | I'm sticking with Windows 7. |
| 17:49.01 | DrodoEmpire | Ya, |
| 17:49.04 | Technobliterator | Google was doing fine on its own and wasn't bothering anyone, then Microsoft comes along and goes "fuk u moar dosh" and makes some dum Bing crap |
| 17:49.21 | DrodoEmpire | Bing can go f*ck itself, |
| 17:49.26 | DrodoEmpire | Its crap. |
| 17:49.33 | Technobliterator | Nintendo and Sony were fine on their own and then Microsoft goes "moar cash nao" and makes some inferior Xbox |
| 17:49.40 | DrodoEmpire | Actually, |
| 17:49.49 | DrodoEmpire | I quite like the Xbox. |
| 17:49.59 | Technobliterator | Whether you like it or not |
| 17:50.03 | Cyrannian | I don't mind the Microsoft operating systems or most of their products, but I do dislike Bing. |
| 17:50.09 | DrodoEmpire | Ya, |
| 17:50.10 | Technobliterator | Specs-wise it's inferior to the Xbox |
| 17:50.17 | Technobliterator | *PlayStatino |
| 17:50.18 | Technobliterator | dum |
| 17:50.30 | darkscarypie | hi again! :3 |
| 17:50.33 | DrodoEmpire | Its a superior system, |
| 17:50.42 | Technobliterator | I quite like Xbox fair enough but they just didn't seem to have a reason to make it |
| 17:50.44 | Technobliterator | er no |
| 17:50.46 | DrodoEmpire | It deserves to stand on its podium, |
| 17:50.53 | Technobliterator | can xbox run blu rays? i don't think so |
| 17:51.01 | Technobliterator | and there already is a reason it's inferior |
| 17:51.03 | DrodoEmpire | People have to make a living, |
| 17:51.21 | DrodoEmpire | Thats Capitalism, for ya. |
| 17:51.23 | Technobliterator | Microsoft tried to rip off iPods with Zune which was crap, and that was ded cuz Steve Jobs is awesome |
| 17:51.33 | Hachi_ | Microsoft supported SOPA |
| 17:51.33 | Technobliterator | I'm not gonna argue with that |
| 17:51.37 | Technobliterator | But I don't like it |
| 17:51.44 | Cyrannian | I actually had both an Xbox and a PS3, I definitely preferred the Xbox. |
| 17:51.53 | DrodoEmpire | Same here, |
| 17:51.58 | Technobliterator | Whether you prefer it, I have no problem |
| 17:52.03 | Hachi_ | I don't mind either console |
| 17:52.06 | Irskaad | Valve OS. Say goodbye to the competition, |
| 17:52.08 | Irskaad | .* |
| 17:52.10 | Technobliterator | But the processor and the disc reader of the PS3 is superior |
| 17:52.34 | Hachi_ | Gamecube will always be my favourite console though |
| 17:52.38 | Technobliterator | Irskaad: Valve OS? Culd actually happen now that Steam is selling non-game software too |
| 17:52.44 | Technobliterator | hur Gamecube was ded in the market from day 1 |
| 17:52.47 | Irskaad | :3 |
| 17:52.59 | Technobliterator | but still I want Android for desktop more |
| 17:53.11 | Hachi_ | It should've been tons more successful |
| 17:53.28 | DrodoEmpire | But if there is one thing that irks me the most about Microsoft, |
| 17:53.29 | Imperios | Back |
| 17:53.32 | Imperios | Now I have made a pic |
| 17:53.38 | Cyrannian | My original Xbox was very loud when playing games, but they seemed to have solved that problem in the latest versions |
| 17:53.41 | DrodoEmpire | The actual computers themselves, |
| 17:53.46 | Technobliterator | Gamecube's only good exclusives were some Mario games and a MGS remake :v |
| 17:53.48 | Monet | Imperios: Pic of Cathamera? |
| 17:53.54 | DrodoEmpire | They are made of shit, |
| 17:53.55 | Imperios | http://images1.wikia.nocookie.net/spore/images/7/7d/Badmanz_Rising.png What do you think? |
| 17:54.01 | Imperios | Monet: Kinda |
| 17:54.02 | Imperios | Look |
| 17:54.09 | Technobliterator | Imperios: niiice |
| 17:54.18 | Monet | Spooky. |
| 17:54.25 | Technobliterator | Microsoft didn't make computers until they announced the Surface |
| 17:54.27 | OluapPlayer | i liek lots |
| 17:54.34 | DrodoEmpire | Like, you get it, |
| 17:54.39 | Technobliterator | And now all PC manufacturers want to change to Linux because of this :p |
| 17:55.00 | DrodoEmpire | It already has a problem with the fan, |
| 17:55.01 | Imperios | Hachi_ |
| 17:55.05 | Hachi_ | Yush? |
| 17:55.07 | Imperios | Gimme the Tyraz deemun png |
| 17:55.11 | DrodoEmpire | Or something like that. |
| 17:55.12 | Hachi_ | Okaii |
| 17:55.29 | DrodoEmpire | Like, |
| 17:55.34 | Technobliterator | dum hachi it doesn't work when boys do it |
| 17:55.34 | Monet | http://www.youtube.com/watch?v=vaj6YGOLskQ&feature=related I listen to this, it stoppped and my foot is still tapping. |
| 17:55.45 | DrodoEmpire | I had this Windows, |
| 17:55.55 | DrodoEmpire | New for its time, |
| 17:56.32 | DrodoEmpire | Its 14 years old and is still a good computer, |
| 17:56.47 | DrodoEmpire | I got a new computer, |
| 17:56.52 | DrodoEmpire | It sucked. |
| 17:57.12 | DrodoEmpire | Its fan was deafening and it couldn't play games worth shit. |
| 17:57.34 | Technobliterator | Windows make money off their lack of competition |
| 17:57.38 | DrodoEmpire | Its five years old, |
| 17:57.39 | Technobliterator | That should change |
| 17:57.41 | DrodoEmpire | Ya, |
| 17:57.54 | Imperios | Should I make another pic for AW final battle? |
| 17:57.56 | DrodoEmpire | Once the market is monopolised. |
| 17:58.00 | DrodoEmpire | *, |
| 17:58.05 | Technobliterator | if you want imp |
| 17:58.11 | Technobliterator | this is why i hate MS |
| 17:58.12 | DrodoEmpire | Quality goes to shit. |
| 17:58.20 | Technobliterator | they are obsessed with going monopoly mode |
| 17:58.27 | Technobliterator | fucking hate em |
| 17:58.34 | Technobliterator | I hope Apple kicks them in the nuts |
| 17:58.52 | Irskaad | Irskaad's Brain - Monopoly = Board Game? |
| 17:58.57 | DrodoEmpire | No, |
| 17:59.10 | Technobliterator | monopoly = complete dominance of a market |
| 17:59.16 | DrodoEmpire | Exactly, |
| 17:59.17 | Irskaad | Oh |
| 17:59.28 | Hachi_ | Technobliterator: Bill Gates named his company after his dick |
| 17:59.29 | DrodoEmpire | It isn't good for consumers, |
| 17:59.30 | Technobliterator | google "definition monopoly" |
| 17:59.34 | Irskaad | TIL |
| 17:59.40 | Technobliterator | Hachi_: hur you've been watching ERB |
| 17:59.41 | DrodoEmpire | lol, |
| 17:59.45 | Hachi_ | XDD |
| 17:59.49 | Hachi_ | Yes I have |
| 17:59.52 | Irskaad | Would Android monopoly be good? |
| 18:00.01 | Technobliterator | you mean Google monopoly |
| 18:00.05 | Hachi_ | Imperios: http://images2.wikia.nocookie.net/spore/images/a/ae/Demonic_Tyraz_png.png |
| 18:00.10 | Technobliterator | Tough one. |
| 18:00.14 | OluapPlayer | Monopolies are never a good thing |
| 18:00.18 | OluapPlayer | They hinder progress |
| 18:00.22 | Monet | Monopolies are generally bad for capitalism. |
| 18:00.23 | Irskaad | Why |
| 18:00.26 | Technobliterator | Part of me says yes because of Google being all nice and crap |
| 18:00.33 | Technobliterator | and how most of their products are free |
| 18:00.38 | Technobliterator | the othe part of me, says no |
| 18:00.44 | OluapPlayer | No competetion = no innovation = nothing new |
| 18:00.46 | Technobliterator | because of what Monet and Oluap already said |
| 18:01.12 | Technobliterator | If Microsoft had competition, new versions of Windows would be given out free |
| 18:01.18 | Monet | no coompetition = no need for new ideas = no new concepts = no innovation = technology stagnates |
| 18:01.24 | Technobliterator | Like how new Mac OS are |
| 18:01.35 | Technobliterator | Hmm |
| 18:01.40 | Hachi_ | I await the day a company comes out with the first video game you can play with your mind |
| 18:01.41 | Technobliterator | Valve would argue with you there |
| 18:01.55 | Technobliterator | Steam is basically a monopoly of digital sales |
| 18:02.02 | Technobliterator | And it continues to get better |
| 18:02.19 | Technobliterator | Hachi_: this technology is already being developed:v |
| 18:02.20 | DrodoEmpire | It isn't a total monopoly, |
| 18:02.33 | Hachi_ | Nice |
| 18:02.34 | Imperios | Hachi_:Thx |
| 18:03.15 | DrodoEmpire | there is a few poor-quality online retailers still on the market |
| 18:03.15 | DrodoEmpire | Origin, |
| 18:03.17 | Technobliterator | "poor-quality" |
| 18:03.23 | Imperios | http://spore.wikia.com/wiki/Fiction:Andromeda_War/The_Final_Battle#Badmanz_Rising Here more sekshons |
| 18:03.24 | Technobliterator | Exactly, so Valve are still monopoly |
| 18:03.33 | OluapPlayer | yey |
| 18:03.36 | DrodoEmpire | Despite this, |
| 18:03.37 | Technobliterator | Zr'Ahgloth - my part was da bes part |
| 18:03.47 | DrodoEmpire | A lot of people use it, |
| 18:03.56 | DrodoEmpire | Or are forced to by EA, |
| 18:04.29 | Imperios | You know I was forced to sort out this battle a lot |
| 18:04.39 | *** join/#sporewiki Seldeen (18d7c951@gateway/web/qwebirc/irc.wikia.com/ip.24.215.201.81) |
| 18:04.45 | DrodoEmpire | Hello, |
| 18:04.54 | Imperios | Wormy said I should do it |
| 18:05.02 | Catface | Monopoly is a fun game. |
| 18:05.05 | Seldeen | musylous estatud |
| 18:05.14 | Seldeen | ^ReCaptcha of the Dat |
| 18:05.20 | Seldeen | Day* |
| 18:05.34 | Seldeen | Irskaad: #nidlak-arkil |
| 18:05.59 | OluapPlayer | nop, Gratz part was best part |
| 18:06.29 | Monet | Everyone keep posted becasue the AndroGrox are still due to do stuff until the war's official end. |
| 18:07.23 | Irskaad | Grochius III - *Looks* |
| 18:07.50 | Hachi_ | Imperios: hur Br'Klakkon is Harlequin |
| 18:08.01 | Technobliterator | Dalverat's part was the best |
| 18:08.03 | Imperios | Harlequin? |
| 18:08.07 | Imperios | And dat being |
| 18:08.09 | Technobliterator | hurhurhur |
| 18:08.12 | Seldeen | Harleyquinn? |
| 18:08.15 | Seldeen | Wut |
| 18:08.18 | Seldeen | Lol |
| 18:08.22 | Imperios | Br'klakkon - FUK I'M NOT A GIRL |
| 18:08.22 | Monet | Eldar Harlequin? |
| 18:08.46 | Imperios | Although technically |
| 18:08.53 | Imperios | You can say Br'klakkon has a feminine personality |
| 18:09.16 | Hachi_ | Br'Klakkon ghey |
| 18:09.39 | Technobliterator | Falrik Zaarkhun - br'klakkon dum he fall into ma trap hurhur |
| 18:09.47 | Seldeen | Lol |
| 18:09.59 | OluapPlayer | What happened to Gar'dakkra anyway? |
| 18:10.02 | OluapPlayer | Did he survive that fight? |
| 18:10.58 | Monet | It is something of an emotional kick in the crotch when the leader of a neutral Grox faction renames himself to be the successor to your worst enemy. |
| 18:11.04 | Imperios | I agree |
| 18:11.15 | Imperios | I imagine Draconis going FFFFUUUU |
| 18:11.25 | Imperios | Hachi_: Femalr Lorons are smart |
| 18:11.27 | Imperios | Br'klakkon is smart |
| 18:11.32 | Imperios | Br'klakkon is femininie |
| 18:11.35 | Technobliterator | guys |
| 18:11.37 | Hachi_ | Like I said |
| 18:11.38 | Imperios | :> |
| 18:11.41 | Hachi_ | Br'Klakkon ghey |
| 18:11.43 | OluapPlayer | Female Loron are a different species though |
| 18:11.45 | Imperios | Hur |
| 18:11.46 | Technobliterator | raise your hand if you own an UNOC character |
| 18:11.52 | Imperios | raises his hands |
| 18:11.52 | Hachi_ | raises hand |
| 18:12.05 | OluapPlayer | raises Cyrannian's severed hand |
| 18:12.08 | Technobliterator | dum y oluap and monet no raise |
| 18:12.09 | Technobliterator | oh hur |
| 18:12.10 | Imperios | I worked on half of the UNOC |
| 18:12.12 | Technobliterator | So then |
| 18:12.24 | Seldeen | CYRANNNNNNIIIIIAAAAAANNNN |
| 18:12.24 | Technobliterator | You guys want to make a short story for your warboss |
| 18:12.32 | OluapPlayer | nop |
| 18:12.38 | Hachi_ | meh |
| 18:12.38 | Monet | *raises ahnd* sorry was on SPore. |
| 18:12.44 | Technobliterator | except Oluap cos he alread went dum and said no |
| 18:12.57 | Technobliterator | Hachi_: Unfortunael you don't have a choice. |
| 18:12.58 | Technobliterator | :v |
| 18:13.05 | Hachi_ | I brek yoo |
| 18:13.06 | OluapPlayer | lol |
| 18:13.07 | Hachi_ | :^ |
| 18:13.12 | Imperios | I made Lup, helped making Vailisa, made Girlzanes (Kalcedia)... what else? |
| 18:13.15 | Technobliterator | nu |
| 18:13.21 | Imperios | Ah, yes, and I remade Telzoc |
| 18:13.22 | Technobliterator | that's it imp |
| 18:13.26 | Technobliterator | ohyeh |
| 18:13.29 | Hachi_ | Imperios: I made Girlzane |
| 18:13.33 | Technobliterator | Still |
| 18:13.46 | Imperios | Hachi_: Remember their chests? |
| 18:13.50 | Imperios | I made them look good :> |
| 18:13.51 | Hachi_ | Oh yeah |
| 18:13.52 | Hachi_ | lol |
| 18:13.59 | Technobliterator | Remember in the Rogue Boyz defeat story? |
| 18:14.05 | Imperios | Yep |
| 18:14.06 | Hachi_ | Yush? |
| 18:14.07 | Technobliterator | There was one bit we skipped, UNOC vs Warbosses |
| 18:14.09 | Cyrannian | Huh? I've been decapitated? When did this happen? |
| 18:14.21 | OluapPlayer | I didn't decapitate you |
| 18:14.24 | OluapPlayer | I just severed your hand |
| 18:14.31 | Technobliterator | You write the story as your UNOC member smashing a Rogue Boyz warboss |
| 18:14.40 | Cyrannian | For some reason I thought you said "head" |
| 18:14.52 | Technobliterator | but just show it to me on pastie first and stuff |
| 18:15.05 | Imperios | I see |
| 18:15.09 | Technobliterator | well |
| 18:15.14 | Imperios | OluapPlayer: Regarding Gar'dakkra, I do not know myself |
| 18:15.14 | Technobliterator | i'll tell you when you should |
| 18:15.29 | Imperios | Theoretically he could join Da Rogue Boyz, become the new LotB ruler or... any other ideas? |
| 18:15.40 | Monet | I helped with Zelfron III. |
| 18:15.58 | Hachi_ | Imperios: he should be dum and get eaten by HXTs and Kol |
| 18:16.09 | OluapPlayer | kol dum |
| 18:16.15 | OluapPlayer | imma make buni explode him |
| 18:16.22 | Technobliterator | dum y Wormy no raise hand |
| 18:16.38 | Imperios | forces Hachi_ to watch Kiss Players for 10 hours straight |
| 18:16.47 | Hachi_ | -_- |
| 18:17.04 | Imperios | Wait you know what Kiss Players is? |
| 18:17.14 | Irskaad | wants to hug Kol Daren |
| 18:17.14 | Hachi_ | Yush |
| 18:17.23 | Imperios | Dafuk |
| 18:17.30 | Imperios | I thought I was the only Transformers fanboy dere |
| 18:17.33 | Hachi_ | http://upload.wikimedia.org/wikipedia/commons/thumb/6/6b/Shia_LaBeouf_Cannes_2012.jpg/220px-Shia_LaBeouf_Cannes_2012.jpg No fucking way is that Shia |
| 18:17.57 | Technobliterator | shias fit |
| 18:18.06 | Hachi_ | Dat beard don't suit him |
| 18:18.16 | Hachi_ | I liked it when he looked like a manboy |
| 18:18.22 | Cyrannian | http://news.gather.com/viewArticle.action?articleId=281474981532371 - Wormy watch dis |
| 18:18.45 | Irskaad | Isn't Shia a female name |
| 18:18.53 | Technobliterator | no |
| 18:18.56 | Imperios | Hur |
| 18:18.59 | Imperios | BTW |
| 18:19.00 | Technobliterator | he's a male actress |
| 18:19.04 | Imperios | I have a cowboy hat |
| 18:19.06 | Imperios | Male actress |
| 18:19.09 | Imperios | shakes his head |
| 18:19.15 | Irskaad | Lol |
| 18:19.18 | Technobliterator | http://spore.wikia.com/wiki/Fiction:Second_Borealis_Galactic_War/Coming_of_the_Vague#Failed_Freedom The battles should be like this |
| 18:19.23 | Irskaad | Male actor* |
| 18:19.30 | Technobliterator | yeh |
| 18:20.01 | Irskaad | inb4 Female Actor |
| 18:20.02 | Monet | is he of french origin or something? |
| 18:20.09 | Technobliterator | idk |
| 18:20.13 | Technobliterator | all i know is hes fit |
| 18:20.29 | Monet | LeVBeaof makes him sound like he has french parents. |
| 18:20.44 | Monet | LeBaouf* |
| 18:20.45 | Hachi_ | I thought he was of Australian accent |
| 18:21.40 | Hachi_ | Oh wait, his dad was of Cajun descent |
| 18:21.43 | Hachi_ | So yeah, French |
| 18:21.44 | Technobliterator | Imperios Wormy Hachi_ Monet |
| 18:21.48 | Technobliterator | PAY ATTENSHON NGGGH |
| 18:21.54 | Hachi_ | Huh what? |
| 18:21.56 | Imperios | I do |
| 18:22.06 | Technobliterator | [19:19] <Technobliterator> http://spore.wikia.com/wiki/Fiction:Second_Borealis_Galactic_War/Coming_of_the_Vague#Failed_Freedom The battles should be like this |
| 18:22.27 | Technobliterator | You just write a battle as your UNOC member destroying one of the warbosses |
| 18:22.29 | Technobliterator | on pastie and show me |
| 18:22.31 | Irskaad | Jo you just acted like impy for a quick second |
| 18:22.34 | Monet | Okay so which UNOC member vs. who? |
| 18:22.46 | Technobliterator | Zelfron III vs Drizz'pyrokirk |
| 18:22.53 | Technobliterator | Kalcedia vs nar'gank |
| 18:23.03 | Hachi_ | gank lal |
| 18:23.10 | Technobliterator | Lupercal vs Naktor'zak |
| 18:23.13 | Imperios | Irskaad: Why so? |
| 18:23.25 | Technobliterator | and Vaktyl vs Zalk'don but Wormy seems ded |
| 18:23.42 | Hachi_ | Is Nar'gank a snipa too? |
| 18:24.03 | OluapPlayer | Knar'gank is a sniper among other things |
| 18:24.21 | Monet | I swear every time you mentione his name I keep thinking of Drizzt do'urden, Pyro and captain Kirk. |
| 18:24.22 | Technobliterator | Knar'gank |
| 18:24.28 | Technobliterator | Read about your opponent first :v |
| 18:24.37 | Hachi_ | lol |
| 18:24.39 | Technobliterator | [[Captain:Knar'gank]] for your Hachi_ |
| 18:24.39 | morgothBotPy | Technobliterator meant: http://spore.wikia.com/wiki/Captain:Knar'gank |
| 18:24.52 | Monet | A dark elf space captain lady's man in a gas mask and fire-retardent uniform. |
| 18:24.55 | Technobliterator | [[Captain:Drzz'pyrokirk]] for you Monet |
| 18:24.56 | morgothBotPy | Technobliterator meant: http://spore.wikia.com/wiki/Captain:Drzz'pyrokirk |
| 18:25.09 | Technobliterator | [[Captain:Drizz'pyrokirk]] * |
| 18:25.09 | morgothBotPy | Technobliterator meant: http://spore.wikia.com/wiki/Captain:Drizz'pyrokirk |
| 18:25.53 | Technobliterator | [[Captain:Naktor'zak]] & [[Vehicle:Da Propa Big Rogue Tank]] Imperios |
| 18:25.53 | morgothBotPy | Technobliterator meant: http://spore.wikia.com/wiki/Captain:Naktor'zak, http://spore.wikia.com/wiki/Vehicle:Da_Propa_Big_Rogue_Tank |
| 18:26.19 | Imperios | I know who Naktor is |
| 18:26.31 | Imperios | Lupercal will go tank-smacking |
| 18:26.34 | Technobliterator | still read |
| 18:26.34 | Technobliterator | :v |
| 18:26.57 | Technobliterator | and don't belittle them |
| 18:27.19 | Imperios | KAy kay |
| 18:27.23 | Imperios | Who's supposed to win? |
| 18:27.30 | Imperios | One question |
| 18:27.37 | OluapPlayer | Lup |
| 18:27.46 | Imperios | IS there any possibility Lup could take over Naktor's tank |
| 18:27.51 | Imperios | I know it is controlled mentally |
| 18:28.01 | Imperios | But Lup has MAGIC *snort snort* |
| 18:28.05 | OluapPlayer | If you managed to mind-control Naktor |
| 18:28.06 | Wormy | someone bleeped me and now i'm awake |
| 18:28.08 | OluapPlayer | I think it's possible |
| 18:28.11 | Hachi_ | So Kalcedia (based on Sniper Wolf) will be fightin Knar'gank (who seems to be based on The End)? |
| 18:28.48 | OluapPlayer | I updated Gratz' pages with his Andromeda War participation |
| 18:29.06 | Imperios | Damn |
| 18:29.11 | Imperios | I wanted to remind you of this :> |
| 18:29.55 | OluapPlayer | hur |
| 18:30.05 | OluapPlayer | update Br'klakkon and Matheoward's pages :> |
| 18:30.29 | *** join/#sporewiki qwebirc926061 (56974397@gateway/web/freenode/ip.86.151.67.151) |
| 18:30.50 | TechnoIsAway | wormy, you there? |
| 18:30.58 | Monet | Expect lots of ninja moves from Zelfron III. |
| 18:31.07 | TechnoIsAway | lool |
| 18:31.14 | Wormy | I am now |
| 18:31.27 | Imperios | OluapPlayer: I gonna finish ze final battle first |
| 18:31.35 | Hachi_ | So Kalcedia (based on Sniper Wolf) will be fightin Knar'gank (who seems to be based on The End)? |
| 18:31.46 | Technobliterator | Hachi_: he's not really based on the end...but sort of |
| 18:31.51 | Technobliterator | it can be a sniper duel if you want |
| 18:31.57 | Hachi_ | Sniper duel is cool |
| 18:32.01 | OluapPlayer | Knar'gank is a sniper, a hacker, a ninja |
| 18:32.08 | OluapPlayer | He's a lot of sneaky stuff |
| 18:32.11 | Technobliterator | Wormy: okay cool, can you write a little thing then? |
| 18:32.16 | Hachi_ | He reminds me of The End |
| 18:32.19 | Technobliterator | basically, Vaktyl vs a Rogue Boyz warboss |
| 18:32.34 | Technobliterator | Because of his photosynthesis? |
| 18:32.37 | Hachi_ | Yeah |
| 18:32.46 | OluapPlayer | And yes, a plant too |
| 18:32.50 | Technobliterator | the End is a legend |
| 18:33.12 | Hachi_ | Battle of da sneaky boi and the sneaking girl |
| 18:33.35 | Wormy | I don't think you are asking the right person to do it since I barely know who Vaktyl is |
| 18:33.44 | Technobliterator | It's more like Sniper Wolf vs Snake |
| 18:33.53 | Technobliterator | Wormy: dum you're the one who made Vaktyl with me |
| 18:34.12 | Wormy | I need a link |
| 18:35.07 | Technobliterator | [[Captain:Vaktyl]] |
| 18:35.08 | morgothBotPy | Technobliterator meant: http://spore.wikia.com/wiki/Captain:Vaktyl |
| 18:35.13 | Technobliterator | remember this dude? |
| 18:35.34 | Wormy | oh him |
| 18:35.52 | Technobliterator | yeah.:p |
| 18:36.00 | Catface | traps Monet in acrylic glass |
| 18:36.50 | Monet | Wut? |
| 18:36.52 | Wormy | Hm, I may be editing Cyrannian's fiction first later |
| 18:37.01 | Catface | lawl |
| 18:37.09 | Wormy | So not today |
| 18:38.13 | Technobliterator | okaii nvm |
| 18:38.18 | Technobliterator | i'll do it |
| 18:38.33 | Technobliterator | speaking of which |
| 18:38.47 | Technobliterator | now you're done in the andromeda war, is there any chance DCP can be in the Borealis War? |
| 18:39.36 | Wormy | We'll see. I also have the Rights of Earth fiction, DerGrobmann and Catharsis plots |
| 18:40.10 | Wormy | I might be able to fit in Titanozor who is a sort of warrior ambassador |
| 18:40.32 | Wormy | But I'll need help to create a meaningful story |
| 18:40.55 | OluapPlayer | Well the largest evil Grox empire still active is in Borealis |
| 18:41.52 | OluapPlayer | And there's also the Junction |
| 18:41.58 | Hachi_ | DC |
| 18:42.27 | Technobliterator | as well as the BCN hur |
| 18:42.40 | Wormy | For my Hyperspace war, I need to the DCP to attack either The Junction or Cult of the Deathmarch with a hyperspace star detonation. |
| 18:42.43 | OluapPlayer | BCn insignificant compared to the DCP |
| 18:43.04 | OluapPlayer | Attacking the Junction = bad idea |
| 18:43.54 | Wormy | They aren't at their height yet, and a hyperspace star would probably destroy Borealis since it explodes with the mass-energy of the Milky Way (even the dark matter) |
| 18:44.08 | Technobliterator | Falrik Zaarkhun - y i insignifacnt |
| 18:44.12 | Wormy | So I may not attack The Juntion anyway |
| 18:44.20 | OluapPlayer | I wouldn't allow you to anyway :> |
| 18:44.38 | OluapPlayer | Why would the DCP even want to attack the Junction? I though they were on neutral-to-friendly terms |
| 18:44.55 | Wormy | They are, so its not the best of ideas |
| 18:45.07 | Wormy | The Cult of the Deathmarch however... |
| 18:45.17 | Technobliterator | Yeah DC are part of the Cult |
| 18:45.23 | Technobliterator | no wait |
| 18:45.25 | Technobliterator | prt of the Legion |
| 18:45.27 | OluapPlayer | DC aren't part of the Cult |
| 18:45.50 | Monet | http://images2.wikia.nocookie.net/spore/images/e/e3/ImperiumBattleDroidAlpha.png - Dragons have droids too. |
| 18:46.13 | OluapPlayer | dwagon dwoid |
| 18:46.23 | Technobliterator | ngh maek story insted |
| 18:46.37 | Monet | Give me time. |
| 18:46.49 | Technobliterator | i will dw |
| 18:46.52 | Monet | I've been meaning to make that for a while. |
| 18:46.55 | Wormy | I need justification to detonate it. Believe me though, the Hyperspace war that follows will not be good for the DCP. They will get a lot more enemies, worse, the AI Exodium will be able to begin his projects. |
| 18:47.06 | Wormy | It's |
| 18:47.36 | Monet | Exodium - Y I a thing? |
| 18:47.48 | Wormy | In fact the Gigaquadrant will be at risk when Exodium has the ability to fire hyperspace stars at anyone. |
| 18:48.04 | Wormy | Exodium hates the disorder of life. It certainly has no gender |
| 18:48.07 | Cyrannian | Wormy: Did you see that video? |
| 18:48.15 | Technobliterator | it's funny |
| 18:48.22 | Technobliterator | me and wormy did the first ever rp on irc |
| 18:48.26 | Technobliterator | when i first joined the wiki:p |
| 18:48.46 | Wormy | I did, it was strange. It was a good UFO since it has many points of perspective |
| 18:49.01 | Wormy | Its hard to tell whether it is real though |
| 18:49.09 | Wormy | Due to its size |
| 18:49.26 | Cyrannian | Indeed |
| 18:50.12 | Wormy | Monet: Exodium will try to reverse the expansion of the universe for its godlike purposes. |
| 18:50.32 | Hachi_ | Foshi - bitch please |
| 18:50.42 | Wormy | Life creates a lot of disorder, and doesn't help Exodium one bit |
| 18:50.55 | OluapPlayer | exodium mad |
| 18:50.57 | Wormy | Life is an annoyance |
| 18:51.08 | Monet | This is what scares me about AIs. |
| 18:51.50 | Wormy | It can start reversing the expansion of space by turning the universe into a closed one, and that means magically forcing more mass into the universe. It can do this using the hyperspace stars. |
| 18:51.57 | Monet | In their universe of linear and methodic thinking, wehre everything must be organised we are chaos incarnate. |
| 18:52.27 | Irskaad | Tyrekians - bitch please |
| 18:52.34 | Wormy | There are generally four personalities of AI in the Netspace. |
| 18:52.58 | Monet | Irskaad: Was that to me or Wormy? |
| 18:53.02 | Irskaad | Wormy |
| 18:53.18 | Wormy | The beneficial kind, the self-referencial kind which views atoms it can use for something else and is utterly unknowable, the glitchy kind and the evil kind. |
| 18:53.58 | Wormy | We've seen the evil kind - the Grox Meta-Emperor |
| 18:54.23 | Monet | Theian - When you look closely enough, there is no distinction between the living being and the machine. |
| 18:54.51 | OluapPlayer | Alfabusium is a mix of glitchy and evil |
| 18:55.06 | Wormy | I actually think thwe human body works remarkably like a human biocomputer. |
| 18:55.19 | Irskaad | I wonder how would Alfabusa react to Alfabusium |
| 18:55.21 | Wormy | That is a new term to me |
| 18:55.46 | OluapPlayer | Evil because he's a genocidal murderer, glitchy because his Fortress' power is more than he could handle, aming him insane |
| 18:55.57 | OluapPlayer | Not sure if insane is a good word for an AI but that's the idea |
| 18:56.11 | Wormy | In Orions Arm there are insane AI's |
| 18:56.39 | Wormy | Perversities and Blights http://www.orionsarm.com/eg-topic/4c43680d0c9e4 |
| 18:59.35 | Monet | BTW Hachi_ I was thinking of gathering the AGC's members for a post-war meeting of the Andromedan Light. |
| 18:59.46 | Hachi_ | Oh right? |
| 19:00.32 | Monet | We can formally discuss what is to happen next. I presume Xho and Liquid Ink would be able to come too. |
| 19:01.13 | Monet | Falco's ded and I am not sure if we agreed on whether or not protections had a say in the Andromedan Light. |
| 19:01.28 | Wormy_brb3 | Ngh |
| 19:01.32 | Wormy_brb3 | That reminds me! |
| 19:01.37 | Wormy_brb3 | 3 must be lucky |
| 19:01.41 | Irskaad | Will people talk about the new KGGC? |
| 19:02.09 | Irskaad | the AGC* |
| 19:02.09 | Wormy_brb3 | I won 100 latinum by typing in 23, 3 and 32 at dabo in STO |
| 19:02.18 | Monet | Irskaad: Yeah. |
| 19:02.24 | Irskaad | :3 |
| 19:02.36 | Monet | What else would they talk about? |
| 19:02.52 | Monet | Wait I got confused by your statement. |
| 19:03.21 | Monet | No, they won't be discussing the KGGC as far as I am aware. |
| 19:03.49 | Cyrannian | cackles manaically |
| 19:04.01 | Cyrannian | *maniacally |
| 19:04.07 | Cyrannian | And now, inactivity. |
| 19:04.14 | Monet | I presume Edra-Arath don't want to be in the AGC. |
| 19:05.01 | Irskaad | Nope |
| 19:05.35 | Irskaad | If Khaxvis crumble to the point they have no control over the Arath, Arath are going independent |
| 19:06.15 | Monet | Again the AGC is an alliance not a new empire. |
| 19:06.21 | Monet | But fair enough. |
| 19:07.18 | Monet | Logically most join the AGC for protection from raiders, economic benefits and for some say in galactic management. |
| 19:11.39 | *** join/#sporewiki Zmr56 (5225ff69@gateway/web/qwebirc/irc.wikia.com/ip.82.37.255.105) |
| 19:11.39 | Monet | Cyrannian's cackling reminds me, does anyone have anything they would like to discuss at the Gig council? |
| 19:11.45 | Zmr56 | Hai |
| 19:11.49 | Monet | Hi |
| 19:12.11 | *** join/#sporewiki Technobliterator (1f3562b8@gateway/web/freenode/ip.31.53.98.184) |
| 19:13.10 | Technobliterator | ohi again |
| 19:15.12 | Zmr56 | Who will be the new Primach? |
| 19:15.17 | Hachi_ | Technobliterator: I just thought of something |
| 19:15.24 | Technobliterator | yeah..? |
| 19:15.26 | Zmr56 | Seeing as matheword was eaten |
| 19:15.28 | Hachi_ | Zmr56: dat be spoilers |
| 19:15.55 | Hachi_ | If Snake managed to sneak his smokes into Alaska in his stomach, thanks to supressed stomach acids, how did he get them back out? |
| 19:17.20 | Monet | You don't wanna know... |
| 19:18.11 | Zmr56 | I think new Primach could be Jahric |
| 19:18.19 | Technobliterator | Using nanomachines iirc |
| 19:18.56 | Seldeen | pppiiiiipppplllleeezzz |
| 19:18.59 | Seldeen | hi |
| 19:19.48 | Zmr56 | wut |
| 19:19.59 | Zmr56 | Hur hur hur |
| 19:20.10 | Zmr56 | Me badmanz |
| 19:23.26 | Seldeen | What's happening? |
| 19:23.32 | Seldeen | :"/ |
| 19:23.36 | Zmr56 | Nothing |
| 19:23.40 | Seldeen | Ah |
| 19:23.45 | Seldeen | Ahaha... |
| 19:23.59 | Zmr56 | ¬_¬ (Got da drugz?) |
| 19:24.07 | Zmr56 | You did not hear that |
| 19:24.51 | Hachi_ | No but I read it |
| 19:24.53 | Irskaad | Imperios were u at |
| 19:25.22 | Technobliterator | dum guys maek unoc vs warbosses nao |
| 19:25.42 | Hachi_ | Fine fine |
| 19:26.03 | Zmr56 | Not enough pressure? MOAR |
| 19:26.16 | Hachi_ | Do UNOC win btw? |
| 19:26.22 | Monet | I think he's busy coding. |
| 19:27.20 | Zmr56 | Just a qustion, who got dark ingection mod |
| 19:31.36 | Imperios | Back |
| 19:32.42 | Zmr56 | Imperio, you got dark injection mod? |
| 19:34.28 | Catface | Monet: I gave a question |
| 19:34.46 | Monet | Catface: Alright, shoot. |
| 19:35.01 | Catface | If a fish had a wish what would a fish wish? |
| 19:36.30 | Catface | Logical question |
| 19:36.36 | *** join/#sporewiki Technobliterator (56967c91@gateway/web/freenode/ip.86.150.124.145) |
| 19:36.51 | Technobliterator | dum net |
| 19:37.04 | Catface | lawl |
| 19:37.28 | Monet | My brain hurts. |
| 19:38.34 | Imperios | Zmr56: I had |
| 19:38.38 | Imperios | And it destroyed my Spore |
| 19:38.45 | Imperios | So shup I won't install it agaib |
| 19:38.52 | Hachi_ | Do UNOC win btw? |
| 19:38.57 | Zmr56 | How come Xho can use it? |
| 19:39.04 | Zmr56 | He's eem fine with it |
| 19:40.00 | Catface | Techno: http://www.youtube.com/watch?v=IwwmglYX7QE |
| 19:40.14 | Technobliterator | Hachi_: yes |
| 19:42.12 | Hachi_ | Do they kill the Warbosses or just defeat them? |
| 19:42.33 | Monet | Defeat them I believe. |
| 19:42.52 | Technobliterator | defeat |
| 19:44.37 | Zmr56 | http://images4.wikia.nocookie.net/spore/images/4/48/Cowboy_Astley.png This is a Radeon cowboy! |
| 19:45.29 | Catface | Does money talk? |
| 19:45.39 | Zmr56 | Yeah |
| 19:45.55 | Irskaad | Should I rename the KGGC to "Groxic Empire of the Kraw Galaxy"? (GEKG) |
| 19:46.12 | Catface | Ye laddy |
| 19:46.42 | Zmr56 | Should there be a new king grouchius III? |
| 19:46.54 | Zmr56 | Seeing as they will be recycled |
| 19:46.57 | Irskaad | Already exists |
| 19:46.58 | Monet | Swap the second G for a C and swap the last two letters and you have a certain terraforming kit. |
| 19:47.22 | Irskaad | So... good idea? |
| 19:47.34 | Technobliterator | don't see why but ok if you want |
| 19:47.56 | Irskaad | Yeah since KGGC is more than a colony by now |
| 19:48.05 | Monet | What about the Grox Neo Meta-Empire? |
| 19:48.36 | Irskaad | They don't go with that name yet because Borealis Grox are stronger |
| 19:48.48 | Monet | It was a thought. |
| 19:48.53 | OluapPlaying | Borealis Grox aren't Meta-Empire aligned |
| 19:49.09 | darkscarypie | why cant you enter gas giants in spore?? |
| 19:49.22 | Imperios | Neo Meta-Empire, yeah, that's a thought |
| 19:49.23 | Zmr56 | Dunno |
| 19:49.32 | Hachi_ | Neo Meta-Empire is cool |
| 19:49.34 | Zmr56 | You can through a glitch |
| 19:49.47 | Imperios | Zmr56: Dammit |
| 19:49.53 | Catface | I love it when full concerts are uploaded on youtube. |
| 19:49.53 | Monet | There isn't realyl much to do on a gas giant. |
| 19:49.53 | Imperios | Gimme dat cowboy |
| 19:49.55 | Imperios | I will use it |
| 19:49.57 | darkscarypie | but tht sucks |
| 19:50.03 | Irskaad | They might change it again depending on the Borealis Grox's future fate |
| 19:50.39 | Zmr56 | Is'nt the PNG downloadble |
| 19:50.46 | Monet | I applaud the Kraw Galaxy's intelligence agencies :P |
| 19:50.57 | darkscarypie | i hope that there will be a stage where you can travel to other galaxys and can goo any gas giant! |
| 19:51.08 | Imperios | Monet: Whatdyamean? |
| 19:51.21 | Zmr56 | Other galaxies are too far away |
| 19:51.23 | *** join/#sporewiki Wormy (d92bf40d@gateway/web/freenode/ip.217.43.244.13) |
| 19:51.28 | DrodoEmpire | Hello, |
| 19:51.29 | OluapPlaying | The only ones awaer of the Borealis Grox's deceit of the Meta-Empire are the Nexus Grox |
| 19:51.34 | Zmr56 | worm worm wormy worm worm |
| 19:51.42 | darkscarypie | oh.. D: |
| 19:51.48 | Monet | Well I was speaking in general. |
| 19:51.49 | Wormy | hi |
| 19:51.54 | Technobliterator | hi |
| 19:52.03 | OluapPlaying | Now back to gaym |
| 19:52.08 | darkscarypie | but i hope there will be a spore out where you can enter gas giants! |
| 19:52.13 | Hachi_ | gays* |
| 19:52.20 | Hachi_ | :> |
| 19:52.32 | OluapPlaying | ~strangle Hachi_ |
| 19:52.32 | infobot | ACTION strangles Hachi_ with a keyboard cord. |
| 19:52.39 | Zmr56 | Just saying, you can through glitch |
| 19:52.41 | Technobliterator | oluap, how are you doing in the game? |
| 19:52.44 | Monet | Spore is ded. |
| 19:52.48 | Zmr56 | Some vids of it on youtube |
| 19:52.48 | OluapPlaying | Good so far |
| 19:52.51 | OluapPlaying | Just won a match |
| 19:52.56 | Zmr56 | Wiki is alive |
| 19:53.00 | Wormy | Technobliterator: I think I'll write some parts in that war of yours, using Vactyl and Titanozor |
| 19:53.02 | Technobliterator | against like real people and stuff? |
| 19:53.16 | OluapPlaying | Yes |
| 19:53.21 | Technobliterator | Wormy: cool nice one!!:) and maybe you can get involvedin rps? |
| 19:53.34 | Technobliterator | is thre any like leagues and ladders that you're in? |
| 19:53.36 | Zmr56 | Wiki community vs Spore community We win |
| 19:53.36 | DrodoEmpire | Monet: All because of those c*nts at EA. |
| 19:53.41 | Wormy | But first I need to write something in Um';s fiction and finish the current Dergrobmann story |
| 19:53.45 | DrodoEmpire | They milked Spore, |
| 19:53.49 | Technobliterator | i c |
| 19:53.57 | DrodoEmpire | and discarded it after they where done. |
| 19:53.57 | Zmr56 | Sims is the only thing they do at EA |
| 19:54.00 | DrodoEmpire | 3: |
| 19:54.04 | Technobliterator | no |
| 19:54.07 | Technobliterator | Mass Effect |
| 19:54.16 | Zmr56 | Oh yeah |
| 19:54.24 | Technobliterator | battlefield...ea sports... |
| 19:54.44 | Zmr56 | As long as this wiki is alive, people have a reason to play Spore |
| 19:54.51 | Monet | EA sports has been milked fro mday 1. |
| 19:54.54 | Zmr56 | But it'sreally glitchy though |
| 19:54.54 | Technobliterator | people still play it |
| 19:55.03 | DrodoEmpire | Thankfully, |
| 19:55.07 | Catface | Battlefield is pretty fun, actually. |
| 19:55.09 | Technobliterator | the game still has a thriving community |
| 19:55.12 | Technobliterator | it's jus dying |
| 19:55.13 | DrodoEmpire | Ya, |
| 19:55.24 | Technobliterator | Battlefield >>> COD |
| 19:55.30 | Technobliterator | well |
| 19:55.30 | DrodoEmpire | Kinda sad, really. |
| 19:55.35 | Zmr56 | Wiki is ALIVE! |
| 19:55.36 | darkscarypie | i have some ideas of the future spore stages:cell,aquatic,creature,tribe,city,space and gas stage where you can almost enter gas giants if your own spaceship is strong eugh! isnt that a great idea?? :D or not.. |
| 19:55.55 | Technobliterator | Spore 2 may come out after SimCity |
| 19:55.56 | Technobliterator | idk |
| 19:56.05 | Zmr56 | Hyper advanced empires from ze past would be cool |
| 19:56.14 | Hachi_ | I lol every time I remember that Tyraz lobbed off Hagto's ankles] |
| 19:56.18 | Technobliterator | EA aren't that bad tbh |
| 19:56.18 | darkscarypie | spore 2!?! what do you mean by??? |
| 19:56.25 | DrodoEmpire | I hope to God there will be a Spore 2 someday... |
| 19:56.26 | Technobliterator | what do you think i mean |
| 19:56.30 | Technobliterator | a new Spore game |
| 19:56.31 | Technobliterator | :L |
| 19:56.36 | darkscarypie | oh.. |
| 19:56.38 | Zmr56 | This wiki should be a game |
| 19:56.38 | Technobliterator | But yeah |
| 19:56.43 | Technobliterator | EA aren't that bad. |
| 19:56.48 | Zmr56 | A story mode |
| 19:56.48 | DrodoEmpire | Oh, |
| 19:56.53 | Technobliterator | I know you guys may rant at me, but they're not. |
| 19:56.55 | DrodoEmpire | They are very bad. |
| 19:57.02 | DrodoEmpire | Exploitive, |
| 19:57.05 | Zmr56 | When it comes to Spore |
| 19:57.06 | DrodoEmpire | Evil, |
| 19:57.10 | Catface | EA just has a habit of buggering up good games. |
| 19:57.12 | DrodoEmpire | Moneymakers. |
| 19:57.16 | darkscarypie | but i hearded.that on the old spore..that the aquatic stage was glitchy |
| 19:57.18 | Technobliterator | "Moneymakers" |
| 19:57.26 | DrodoEmpire | As in, |
| 19:57.27 | Technobliterator | Hold on, they're a corporation. OF COURSE they're moneymakers |
| 19:57.40 | Hachi_ | Cuz making money is a bad thing |
| 19:57.42 | Technobliterator | "Exploitive" |
| 19:57.42 | Hachi_ | Apparently |
| 19:57.43 | DrodoEmpire | That is all they f*cking care about, |
| 19:57.51 | Technobliterator | More so than Activision? |
| 19:57.51 | Catface | All I care about. |
| 19:58.00 | Zmr56 | No stealing money is a fun thing |
| 19:58.11 | DrodoEmpire | They don't give a rat's ass about the community. |
| 19:58.11 | Technobliterator | Of course it is Drodo, it's the *developers* who cre about the game. EA are a publisher. |
| 19:58.16 | Imperios | Hachi_ is a communist :> |
| 19:58.19 | Technobliterator | Is that right? |
| 19:58.25 | Hachi_ | Bleh, Treyarch > Activision |
| 19:58.33 | DrodoEmpire | True, |
| 19:58.39 | Zmr56 | Wiki int game= epic |
| 19:58.43 | DrodoEmpire | Ya, |
| 19:58.44 | Hachi_ | At least when I play a Treyarch CoD game I can enjoy it |
| 19:58.45 | Technobliterator | Battlefield Premium was released because of fan requests |
| 19:58.45 | Zmr56 | *into |
| 19:58.57 | Technobliterator | dum Hachi_ you'fe confusing Infinity Ward and Activision |
| 19:59.03 | Technobliterator | Activision = publishers of COD |
| 19:59.11 | DrodoEmpire | I'm not saying Activision is any better, |
| 19:59.14 | Technobliterator | Infinity Ward = modern warfare developers |
| 19:59.27 | DrodoEmpire | I've heard a lot about them, too. |
| 19:59.31 | Hachi_ | Then where does Treyarch come into it? |
| 19:59.31 | Technobliterator | I'm just saying the main reason people hate EA is just because hating them is cool. |
| 19:59.42 | Zmr56 | There okay |
| 19:59.43 | Technobliterator | Treyarch are the developers of black ops and stuff |
| 19:59.57 | Zmr56 | Zmr56 make really great games |
| 19:59.59 | Hachi_ | I thought Treyarch also made W@W? |
| 20:00.03 | Technobliterator | they did |
| 20:00.03 | Zmr56 | Epic guy |
| 20:00.07 | DrodoEmpire | There are legitimate reasons for hating EA, though, |
| 20:00.13 | darkscarypie | brb my plug crashes |
| 20:00.19 | Hachi_ | So yeah, Treyarch nearly always puts a zombie mode in |
| 20:00.21 | Technobliterator | Maybe. But as much as people do? No |
| 20:00.35 | Hachi_ | So I only really buy a CoD game for zombies and campaign |
| 20:00.37 | Technobliterator | EA are actually nice to developers. |
| 20:00.44 | Imperios | You know, I don't care |
| 20:00.48 | Catface | Old CoD was pretty good. |
| 20:00.48 | Imperios | personally |
| 20:00.50 | Technobliterator | shut up imp |
| 20:00.53 | Imperios | And neither should you, IMO |
| 20:00.56 | Technobliterator | if you on't care don't comment./ |
| 20:00.58 | Imperios | Why should we hate or not hate? |
| 20:01.04 | Technobliterator | shut up man let us talk |
| 20:01.04 | Imperios | I don't understand why do you hate |
| 20:01.17 | Imperios | Okay |
| 20:01.21 | Technobliterator | good |
| 20:01.24 | Technobliterator | Now what I was saying |
| 20:01.54 | Technobliterator | Activision refuse to support any franchise unless they can run it into the ground. This has actually been quoted from Activision themselves |
| 20:02.19 | Hachi_ | I don't hate on any corporations based on reputation. Everybody's gotta make money somehow. |
| 20:02.20 | Technobliterator | Activision's main guy said he wanted the game industry to function more as a shopping market business and less as a fun thing |
| 20:02.28 | DrodoEmpire | Once again, |
| 20:02.39 | Catface | As long as they make good product I don't care. |
| 20:02.42 | Technobliterator | EA are friendly and supportitive to all developers |
| 20:02.48 | DrodoEmpire | I'm not saying that Activision is the "Good Guy", |
| 20:02.50 | Hachi_ | I agree with Catface |
| 20:02.51 | Imperios | Technobliterator: I support Catface |
| 20:02.58 | DrodoEmpire | They are probably worse, |
| 20:03.05 | DrodoEmpire | Actually, |
| 20:03.10 | DrodoEmpire | they are worse, |
| 20:03.21 | Zmr56 | Old games are the best |
| 20:03.21 | DrodoEmpire | bit still, |
| 20:03.21 | Imperios | Why if I do say "I don't care" you got angry while if others do you don't? |
| 20:03.23 | Imperios | *get |
| 20:03.25 | Monet | My main problem with EA is theri impossible deadlines. |
| 20:03.31 | Catface | ^ |
| 20:03.33 | Technobliterator | They'll pay money to a developer to support them to make it a success, and if it's a failure then they ask for no money |
| 20:03.41 | Zmr56 | Creature Keeper looked boring |
| 20:03.46 | Technobliterator | Imperios: because you just came and trashed on a discussion for no reason |
| 20:04.01 | Imperios | I hope you won't hold a grudge or something |
| 20:04.07 | Technobliterator | omg |
| 20:04.08 | Imperios | I just find such conflicts meaningless |
| 20:04.10 | DrodoEmpire | You know what, |
| 20:04.13 | Technobliterator | you know me by now that i don't. |
| 20:04.15 | Imperios | I know you usually don't |
| 20:04.17 | Imperios | I know |
| 20:04.17 | Catface | Who was fighting? |
| 20:04.20 | Zmr56 | Was Spore ever advertised in the U.K? |
| 20:04.22 | Imperios | I am just saying |
| 20:04.23 | DrodoEmpire | Whatever. |
| 20:04.24 | Hachi_ | Valve - So many 3s nowadays... |
| 20:04.25 | Imperios | I often say that |
| 20:04.25 | Monet | Trying to make a good game within a year is pretty hard. |
| 20:04.32 | Technobliterator | Zmr56: nothing ever is:p |
| 20:04.45 | DrodoEmpire | Anctivision is the worse company, |
| 20:04.47 | Wormy | There is nothing extra specialy evil about EA that stands them out from other corporations. They don't all have to be cuddly and cute like Valve |
| 20:04.56 | DrodoEmpire | I know that. |
| 20:05.10 | Technobliterator | that's the point i'm trying to make Wormy |
| 20:05.11 | Imperios | Technobliterator: I know, that's my opinion: We shouldn't conflict because we like this thing or that thing. IMO everybody should have his own opinion |
| 20:05.15 | DrodoEmpire | But that doesn't change the fact, |
| 20:05.18 | Imperios | His or her |
| 20:05.19 | Imperios | Ok |
| 20:05.23 | DrodoEmpire | They killed Spore. |
| 20:05.28 | Zmr56 | What about other? |
| 20:05.32 | Zmr56 | Like Foshi |
| 20:05.35 | DrodoEmpire | Which I really don't like, |
| 20:05.36 | Hachi_ | Huh? |
| 20:05.38 | Wormy | Zmr56: Yes I remember Spore adverts in the UK, in fact UK got Spore before US strangely enough, but after Australia. |
| 20:05.43 | Imperios | What's your response jo? |
| 20:06.03 | Technobliterator | How did EA kill Spore |
| 20:06.08 | Zmr56 | Mka ethis wiki intoa game=everyone happy |
| 20:06.11 | DrodoEmpire | Think about it, |
| 20:06.11 | Wormy | Jo: Its just my opinion these days |
| 20:06.16 | Hachi_ | Spore didn't remove content to be assholes |
| 20:06.18 | Hachi_ | EA* |
| 20:06.23 | Imperios | Technobliterator: You do have a point |
| 20:06.28 | DrodoEmpire | Spore was big when it came out, |
| 20:06.31 | Technobliterator | Making spinoffs was a Maxis thing, not an EA thing |
| 20:06.35 | Imperios | Actually you both do |
| 20:06.40 | DrodoEmpire | it slowly lost popularity, |
| 20:06.45 | Imperios | Spore stagnates; it is in a state of agony |
| 20:06.45 | DrodoEmpire | and then, one day, |
| 20:06.49 | Wormy | To be fair a lot of that demo stuff was just ideas the devs were using. What we saw wasn't the real game. |
| 20:06.53 | Technobliterator | "it slowly lost popularity" |
| 20:06.53 | Imperios | It neither dies nor lives |
| 20:06.56 | Hachi_ | Not EA's fault it lost popularity. |
| 20:06.58 | Catface | Techno: Off topic but do you think its odd that I judge a band based on how good they perform live? |
| 20:06.59 | Technobliterator | ^ |
| 20:07.04 | DrodoEmpire | EA pulled the plug. |
| 20:07.07 | Technobliterator | Exactly, that happens with anything |
| 20:07.08 | Imperios | Technobliterator: Do you actually listen to me? |
| 20:07.15 | Technobliterator | Catface: nope...i see your point |
| 20:07.24 | DrodoEmpire | You know, |
| 20:07.27 | DrodoEmpire | never mind, |
| 20:07.28 | Technobliterator | Imperios: well no because i can't hear yourvoice and i can't "listen" to text on a screen. |
| 20:07.34 | Hachi_ | EA pulled the plug AFTER it lost popularity |
| 20:07.39 | Imperios | In a metaphonrical sense |
| 20:07.42 | Imperios | Jo come on |
| 20:07.47 | Hachi_ | They can't just stick with one game for their whole company lives either |
| 20:07.52 | Wormy | Also, do any of you know that Maxis lost a lot of its employees during development? That might be something to do with it. |
| 20:07.55 | Imperios | You understand what I am saying |
| 20:07.57 | DrodoEmpire | you obvieously know a lot more than me, |
| 20:08.06 | DrodoEmpire | So I'm just gonna drop it, |
| 20:08.06 | Technobliterator | Even keeping the servers online for a 4 year old game is asking a bit much |
| 20:08.13 | Hachi_ | Yeah |
| 20:08.15 | Catface | Techno: Okay because someone said I was stupid for thinking that wat :V |
| 20:08.18 | Wormy | Indeed |
| 20:08.20 | Hachi_ | Matrix Online ran for a long time |
| 20:08.31 | Catface | *way |
| 20:08.40 | Imperios | Technobliterator: Come on why do you keep being angry at me? |
| 20:08.48 | Technobliterator | It's expensive to do, and pretty difficult. WoW's staff aren't just game masers and developers |
| 20:08.54 | Imperios | As I say |
| 20:08.55 | Technobliterator | Imperios: uh...what? |
| 20:09.08 | Hachi_ | People agreed that when the Matrix films lost popularity, so did the game. So they figured "What's the point of keeping it up?" |
| 20:09.11 | Wormy | I don't think anyone here is angry |
| 20:09.14 | Imperios | C'mon you do not respond to my posts and when I asked you why you responded in a condescending manner |
| 20:09.17 | Technobliterator | Catface: i think they're stupid for not understanding why. it's a valid reason to like/dislike a band. |
| 20:09.20 | Zmr56 | Most games like Pokemon are losing popularity because everyone likes CoD or Black OPs |
| 20:09.29 | Imperios | So, here is my opinion |
| 20:09.29 | Wormy | Still I've only been here 5 mins |
| 20:09.36 | Zmr56 | Even 4 year olds play it |
| 20:09.41 | Technobliterator | Imperios: i'm trying to talk to at least 8 people at once...quit being impatient |
| 20:09.44 | Zmr56 | Cod |
| 20:09.51 | Technobliterator | i only have one keyboard and two hands. |
| 20:10.00 | Imperios | Technobliterator: But why did you act condescending to me? |
| 20:10.04 | Imperios | There and now |
| 20:10.08 | Technobliterator | and i don't even know what to respond |
| 20:10.08 | Hachi_ | Zmr56: Then it is obvious Nintendo can't keep up with the EA/Activision market |
| 20:10.14 | Wormy | Dum use your time travel powers |
| 20:10.27 | Imperios | EA does maintain the Spore servers, letting it live, but otherwise keeps it dead |
| 20:10.31 | Imperios | So you both have a point |
| 20:10.37 | Imperios | It is a state between life and death |
| 20:10.39 | Technobliterator | Wormy: time powers can't magic keyboards here sadly |
| 20:10.47 | Wormy | Sad |
| 20:11.05 | Technobliterator | i'd have to deny my past/future self access to a keyboard |
| 20:11.06 | Zmr56 | Imagine pokemon Cod crossover |
| 20:11.14 | Zmr56 | Pickachu witha gun |
| 20:11.18 | DrodoEmpire | That would be fucked up, |
| 20:11.22 | Zmr56 | Lol |
| 20:11.23 | DrodoEmpire | period. |
| 20:11.26 | Zmr56 | RAWR |
| 20:11.32 | Hachi_ | The new Pokemon Conquest game looks interesting |
| 20:11.39 | Hachi_ | I'd buy another DS for it |
| 20:11.41 | Zmr56 | That is a crossover |
| 20:11.55 | Zmr56 | I liked Spyro |
| 20:12.01 | Hachi_ | What's it crossovered with? |
| 20:12.26 | Zmr56 | Some japanese game |
| 20:12.35 | Technobliterator | 3DS is bad and nintendo should feel bad |
| 20:12.35 | Catface | Have some Symphony X http://www.youtube.com/watch?v=RBOu_tWJVC0&feature=related |
| 20:12.49 | Hachi_ | Nobunaga's Ambition |
| 20:13.03 | Technobliterator | Catface: that intro is freaking immense. |
| 20:13.12 | DrodoEmpire | 3DS doesn't look too bad, |
| 20:13.18 | Hachi_ | Original DS is best |
| 20:13.22 | DrodoEmpire | Mecrenares 3D looks cool. |
| 20:13.30 | Technobliterator | It's a gimmicky piece of crap, let's be honest. |
| 20:13.42 | DrodoEmpire | How so? |
| 20:13.51 | Hachi_ | Original DS was best in the fact you could knock somebody out with it and have it not break |
| 20:14.03 | Technobliterator | It's only feature is its 3D capability |
| 20:14.07 | Hachi_ | Now DS's are like pieces of paper |
| 20:14.15 | Catface | Techno: I know |
| 20:14.22 | DrodoEmpire | Meh, |
| 20:14.34 | Technobliterator | Portable consoles are dead |
| 20:14.39 | Technobliterator | in their current state |
| 20:14.44 | Technobliterator | PSVita and 3DS prove this |
| 20:14.51 | Wormy | I'll be back later |
| 20:14.55 | Hachi_ | Console gaming is still in season |
| 20:15.01 | Technobliterator | Game makers need to think about the industry |
| 20:15.05 | Technobliterator | a lot |
| 20:15.23 | Technobliterator | And judging by Sony's purchase of Gaikai and cloud gaming, it looks hopeful that they are |
| 20:15.33 | Technobliterator | cloud gaming's the future:v |
| 20:15.36 | Hachi_ | Anybody rememer Tamagotchi and how much money their company made? |
| 20:15.53 | Technobliterator | i had a tamagotchi! |
| 20:15.55 | Technobliterator | it dieed |
| 20:16.10 | Imperios | I had one |
| 20:16.17 | Catface | I never had one. |
| 20:16.26 | Hachi_ | I admit to having one |
| 20:16.49 | Hachi_ | As did my ex girlfriend and some of her friends |
| 20:16.51 | Monet | I was never really interested. |
| 20:16.54 | Hachi_ | Oh and her little brother |
| 20:16.56 | Technobliterator | http://www.youtube.com/watch?v=k-NnCXeQz9E&feature=g-vrec someone made zombie survival with starcraft's editor |
| 20:16.59 | DrodoEmpire | Homeworld theme: http://www.youtube.com/watch?v=hOJaXybK4_A |
| 20:17.24 | Monet | DrodoEmpire: That music makes me cry. |
| 20:17.28 | Hachi_ | Technobliterator: I seen that! |
| 20:17.28 | DrodoEmpire | Such a sad and melancholy game, |
| 20:17.31 | DrodoEmpire | Ya, |
| 20:17.56 | DrodoEmpire | Yet it's one of the best RTSes of all time. |
| 20:18.36 | Catface | You know something at annoys me? Whenever a band changes its line up all the time. |
| 20:19.02 | Hachi_ | Alongside StarCraft/2, Supreme Commander, Red Alert, Command & Conquer |
| 20:19.08 | DrodoEmpire | Ya, |
| 20:19.45 | Technobliterator | StarCraft 2 > any other rts |
| 20:19.53 | DrodoEmpire | True, |
| 20:19.54 | Monet | hachi: I have played all but SupCom and want to play SupCom. |
| 20:20.03 | Hachi_ | SupCom is amazing |
| 20:20.28 | Hachi_ | I cannot even begin to explain how much epicness is stored in that game |
| 20:20.36 | Catface | Rome total war and Shogun 2 total war will always be among the best rts games. |
| 20:20.40 | Hachi_ | But thing is, you need a fast and powerful computer |
| 20:20.53 | Hachi_ | The Total War series is pretty cool too |
| 20:21.15 | Monet | I am a complete sucker for games. |
| 20:21.33 | Catface | I really want to play Endless Space. |
| 20:21.39 | Technobliterator | ngh i wanna make a mod in starcraft |
| 20:21.48 | DrodoEmpire | Can you guys imagine the Homeworld opening secuence with modern graphics? |
| 20:21.58 | DrodoEmpire | That would be mind-blowing. |
| 20:22.21 | Hachi_ | Unfortunately Dawn of War series doesn't stand on a winning podium in terms of RTS |
| 20:22.28 | Hachi_ | At least, not the original Dawn of War |
| 20:24.28 | DrodoEmpire | In one of the first missions, |
| 20:24.30 | Catface | Monet: Buy me Endless Space |
| 20:24.38 | DrodoEmpire | I think its the third one, |
| 20:24.45 | Monet | I want it too! |
| 20:24.55 | Catface | You can buy you a copy, too. |
| 20:24.59 | DrodoEmpire | I only managed to save two Cryo-Trays 3: |
| 20:26.30 | Hachi_ | Endless Space? |
| 20:26.38 | Technobliterator | dum imp and hachi y u no make sections |
| 20:26.39 | Monet | http://www.youtube.com/watch?v=vAPFCNxRRLw this was a nice song to start Cataclysm. |
| 20:26.48 | DrodoEmpire | no, |
| 20:26.56 | DrodoEmpire | Homeworld. |
| 20:27.29 | Imperios | Technobliterator: I am currently making Andromeda War's final sections |
| 20:27.31 | Hachi_ | Becuz I'm stuck at what to right |
| 20:27.34 | Imperios | I will try to do the sections tomorrow |
| 20:27.34 | Hachi_ | write* |
| 20:27.46 | Monet | The Taiidani had a solid theme. Good to see the sequel kept it. |
| 20:27.47 | Technobliterator | okay |
| 20:27.52 | Technobliterator | Hachi_: just write stuff:v |
| 20:27.58 | Technobliterator | it doesn't have to be long |
| 20:31.34 | *** join/#sporewiki Imperios_ (b24219a0@gateway/web/freenode/ip.178.66.25.160) |
| 20:31.54 | Imperios_ | Dum google |
| 20:32.00 | Imperios_ | Fortunately I work in Akelpad |
| 20:32.36 | Imperios_ | Monet: Could you do the image for the final final final part of the AW? |
| 20:33.03 | Monet | That's everyone vs. br'Klakkon right? |
| 20:34.21 | Imperios_ | No |
| 20:34.22 | Imperios_ | After that |
| 20:34.43 | Imperios_ | Celebrations and stuff |
| 20:35.22 | Monet | Oh right. I suppose I could. |
| 20:35.47 | Monet | I have yet to design a great hall so I can do that. |
| 20:36.01 | Imperios_ | BTW Monet |
| 20:36.17 | Monet | yes? |
| 20:36.27 | Imperios_ | I have been talking with Irskaad about KGGC mass-producing Project Infinity |
| 20:36.28 | Imperios_ | :> |
| 20:36.48 | Imperios_ | AGC Highlords - FFFFUUUU |
| 20:36.58 | Monet | Dis sounds very bad. |
| 20:37.24 | Irskaad | Grochius III - Now do you want to come here? No? I thought so. |
| 20:37.28 | Imperios_ | So, Irskaad, KGGC might basically have Grochius-ish mechs for their commanders and stuff |
| 20:37.39 | Irskaad | :3333333333 |
| 20:38.02 | Imperios_ | Of course for the sake of sanity and balance KGGC ones could be smaller and weaker, but still, very powerful |
| 20:38.08 | Monet | But wait: are the GEKG capable of post-scarcity? |
| 20:38.28 | Irskaad | Dunno |
| 20:38.41 | Monet | Grochius's suit may be powerful but it is bound to be costly. |
| 20:38.47 | Imperios_ | Yeah, exactly |
| 20:38.58 | Imperios_ | That's why they could make them smaller |
| 20:39.01 | Irskaad | :P |
| 20:39.34 | Monet | Smaller, weaker; I'm not sure of Grochius's original design was intended for mass-production. |
| 20:39.41 | Monet | sure if* |
| 20:40.23 | Monet | test |
| 20:40.39 | Imperios_ | Of course it wasn't |
| 20:40.44 | Imperios_ | It gonna be modified |
| 20:41.36 | Monet | SO basically KGGC are taking the same route as the Adeptus Astartes; for the sake of mass prodution they would be cheap replicas in comparison? |
| 20:42.06 | Imperios_ | Yep |
| 20:42.18 | Imperios_ | GROX MEHREENS TODEH THE ENEMEH IS AT OUR DOOR |
| 20:42.20 | Irskaad | :p |
| 20:42.32 | Irskaad | :33333 |
| 20:43.24 | Imperios_ | THE Grochius' battlesuit could be repaired and used too |
| 20:43.30 | Monet | Nano-manufacturing can bump up the quality compared to a traditional conveyor belt line. |
| 20:43.33 | Imperios_ | Yep |
| 20:43.51 | Monet | And the KGGC is bound ot have that. |
| 20:44.15 | Irskaad | Yus |
| 20:44.36 | Monet | The limit to nano-replication is still going to be materials. |
| 20:45.25 | *** join/#sporewiki Technobliterator (56a7662a@gateway/web/freenode/ip.86.167.102.42) |
| 20:45.35 | Technobliterator | dum internet |
| 20:45.42 | Technobliterator | anyone here who can talk to me about my idea? |
| 20:45.49 | Technobliterator | that i ust had |
| 20:46.05 | OluapPlaying | I don't know what it is but I bet it's dum |
| 20:46.18 | Technobliterator | shup yoo twat |
| 20:46.24 | OluapPlaying | Also I quoted on the GEKG |
| 20:47.17 | Monet | Universe - Son, I am dissapoint. |
| 20:47.32 | Hachi_ | Foshi - Bitch please |
| 20:47.41 | Cyrannian | ~tackle OluapPlaying |
| 20:47.41 | infobot | ACTION tackles OluapPlaying to the ground. |
| 20:47.44 | Technobliterator | well i would tell you oluap but i figured you're busy |
| 20:48.08 | OluapPlaying | Gorf - shup Mew stay down |
| 20:48.27 | Technobliterator | tbh you'd need some basic knowledge of starcraft so unless monet wants my lecture i guess no one will hear:v |
| 20:48.45 | Monet | What was your idea? |
| 20:50.32 | Irskaad | dominaet |
| 20:57.44 | Zmr56 | Back |
| 20:57.57 | Zmr56 | My cuz and sis were on the P.C |
| 21:00.39 | Zmr56 | Whats everyone talking about? |
| 21:02.22 | Cyrannian | Nothing, apparently. |
| 21:03.03 | Zmr56 | Cyrannian btw you are probalay the most good looking on the wiki |
| 21:04.18 | Cyrannian | Well thank you |
| 21:04.29 | Hachi_ | Anyhoo, I need a name for my new story involving Tyraz and Crispy |
| 21:04.32 | Hachi_ | Any ideas for a name? |
| 21:04.42 | Zmr56 | Well, what is it about? |
| 21:04.46 | Technobliterator | mr crispy |
| 21:04.54 | Hachi_ | Basically a political uprising within the Brood |
| 21:04.57 | Zmr56 | Hmm...Call it walkers |
| 21:04.58 | Hachi_ | An incursion |
| 21:05.02 | Technobliterator | idk i'm gonna start developing my game in the next week |
| 21:05.12 | Technobliterator | as wel as doing homework... |
| 21:05.15 | Zmr56 | Your game? |
| 21:05.17 | Hachi_ | Game? |
| 21:05.32 | Technobliterator | yes |
| 21:05.34 | Technobliterator | that was the idea |
| 21:05.38 | Technobliterator | that i had |
| 21:05.43 | Zmr56 | Wut game |
| 21:05.50 | *** join/#sporewiki The_Clanden (41a5a4a8@gateway/web/qwebirc/irc.wikia.com/ip.65.165.164.168) |
| 21:05.51 | Technobliterator | not telling |
| 21:05.56 | DrodoEmpire | Hello, |
| 21:05.57 | Zmr56 | Grr |
| 21:05.59 | Monet | Hello. |
| 21:06.01 | Zmr56 | Hola |
| 21:06.07 | Zmr56 | Welcome to IRC |
| 21:06.07 | The_Clanden | Hey. |
| 21:06.13 | Monet | Hehe I know but I'm not tellnig either :> |
| 21:06.29 | Hachi_ | Gah dangit |
| 21:07.51 | Zmr56 | Darn you |
| 21:08.02 | Monet | U mad? |
| 21:08.10 | Zmr56 | TROLOLOL yes |
| 21:08.29 | Monet | Random trivia: Loron are able to wasily get a Draconis to facepalm sepite the handicap that the latter cannot obscure their faces with theri hands. |
| 21:08.46 | Imperios_ | Loron can defy the laws of physics |
| 21:09.17 | Zmr56 | I can defy the laws of the U.K |
| 21:09.58 | Monet | Come to think of it, a Draconis "snoutpalm" could be the equivilent of pinching your nose. |
| 21:10.27 | Monet | It might be easier to explain with a diagram. |
| 21:12.41 | Zmr56 | btw who saw Cowboy Astley? |
| 21:12.51 | Zmr56 | On the wiki photos |
| 21:13.11 | Zmr56 | He's a cowboy Radeon |
| 21:15.17 | DrodoEmpire | F2P: http://www.youtube.com/watch?v=svQ-uerFDu4&feature=related - Its open season, everyone! |
| 21:16.20 | Monet | heh, watched that last night. |
| 21:17.21 | Zmr56 | Can't hear it :p Sz headphones ded |
| 21:18.28 | Imperios_ | I have nearly done the Andromeda War |
| 21:18.30 | Imperios_ | Yesssss |
| 21:18.39 | Zmr56 | YessssssssssssssssBOOM |
| 21:18.43 | Zmr56 | Creeper |
| 21:19.10 | Cyrannian | ~seen Xho |
| 21:19.19 | infobot | xho <5ac81198@gateway/web/freenode/ip.90.200.17.152> was last seen on IRC in channel #sporewiki, 5h 52m 40s ago, saying: 'Too difficult a question'. |
| 21:19.24 | Cyrannian | dum |
| 21:19.41 | Irskaad | wants to hug Xho again for some reason |
| 21:22.15 | Cyrannian | Because you like it when he hates you? |
| 21:22.45 | Imperios_ | http://spore.wikia.com/wiki/Fiction:Andromeda_War/The_Final_Battle#Darkness_Unleashed AND HERE ANDROMEDA WAR ENDS |
| 21:22.53 | Zmr56 | YES!!!!!!!!!!!!!! |
| 21:22.58 | Zmr56 | Partay! |
| 21:23.17 | DrodoEmpire | The Vicious Cycle of 2fort: http://www.youtube.com/watch?v=B36BXid7iQ0 |
| 21:23.35 | Irskaad | The Andromeda War's ending is one of the saddest I've ever seen... *Cries* |
| 21:23.49 | Imperios_ | C'mon Grochius had to die |
| 21:24.07 | Irskaad | Such a sad, sad ending... |
| 21:24.07 | Imperios_ | The fall of Andromeda Grox allowed you to have all this cool stuff |
| 21:24.09 | Imperios_ | Now zzzz |
| 21:24.29 | Irskaad | Grochius III - *Slaps Irsk* THINK ABOUT THE NEW AGE |
| 21:24.53 | Irskaad | Me - Hey, stop slapping- *Grochius III hits him with a Timebreaker* |
| 21:30.41 | Cyrannian | Xho rarely comes on this late at night, right? |
| 21:32.04 | TechnoStarcraft | that;s right |
| 21:32.43 | Monet | During term time he is not on after 10pm. |
| 21:33.36 | Zmr56 | I knew it! Jaharic is the new Primach! I was right! |
| 21:35.05 | Zmr56 | Right, nao Borelias |
| 21:36.18 | Zmr56 | Is Mali'Nar Loron geeza really ded? |
| 21:40.23 | Technobliterator | yeah |
| 21:40.36 | Irskaad | mourns his death |
| 21:41.26 | *** join/#sporewiki Xho (5ac81198@gateway/web/freenode/ip.90.200.17.152) |
| 21:41.31 | Technobliterator | hi xho |
| 21:41.36 | Xho | Harro |
| 21:41.38 | Technobliterator | Well no more Andromeda War |
| 21:41.48 | Technobliterator | hur Borealis War is now biggest war going on at the moment |
| 21:41.53 | Monet | All done, all bad guys dead. |
| 21:41.58 | Irskaad | Xho always cheers me up during time of mourning... Poor Br'lakkon and Grochius II... |
| 21:42.12 | Xho | I'll pretend you're not here then |
| 21:42.22 | Hachi_ | Br'Klakkon got pwned by Tyraz and Iovera |
| 21:42.23 | Irskaad | 3: y i riki now |
| 21:42.42 | Monet | Grochius was bat-shit insane and br'klakkon's a douche. |
| 21:43.23 | Technobliterator | im stillc onfused |
| 21:43.26 | Technobliterator | *confused |
| 21:43.33 | Technobliterator | what happened to the artifacts? |
| 21:43.51 | Cyrannian | Hooray, Xho |
| 21:44.00 | Xho | Cyrannian: painis. |
| 21:44.07 | Cyrannian | u |
| 21:44.14 | Rikimaru | is not scared |
| 21:44.23 | Xho | I was playing Borderlands today |
| 21:44.25 | Monet | U ninja wannabe. |
| 21:44.28 | Xho | My friend was level 3 |
| 21:44.33 | Xho | Another was 24 |
| 21:44.35 | Xho | I was 69 |
| 21:44.49 | Monet | Ouch. |
| 21:44.50 | Rikimaru | Ninja? were |
| 21:45.12 | Monet | *the real Rikiamru teleports in and kicks Riki in the side of the head* |
| 21:45.15 | Technobliterator | owned |
| 21:45.21 | Monet | Rikimaru* |
| 21:45.27 | Rikimaru | How the hell did you see me |
| 21:45.58 | Monet | Riki - Ninja senses *leaps away* |
| 21:46.23 | Hachi_ | TMNT - Bitch please |
| 21:46.43 | Rikimaru | I'm the real riki, I'm the dota riki |
| 21:47.47 | Monet | I doubt that. |
| 21:48.09 | Technobliterator | prevents the DotA mod from being created in Warcraft III |
| 21:48.11 | Technobliterator | u not exist |
| 21:48.26 | Irskaad | kills himself |
| 21:48.44 | Monet | How can you kill yourself over it if you never realised it existed? |
| 21:48.45 | Technobliterator | loool |
| 21:48.48 | Technobliterator | ^ |
| 21:49.12 | Xho | And so forth brainfucking paradox |
| 21:49.26 | Hachi_ | ohgodwat |
| 21:50.10 | Monet | I am a fan of Doctor Who and Star Trek; I should at least know something about time travel. |
| 21:51.34 | Monet | Alternate dimensions, godrealms, the past, the future, alternate persent days; alternate universes Star Trek did it all! |
| 21:51.53 | Xho | I don't think Hell did it |
| 21:51.54 | Irskaad | Really? |
| 21:52.27 | Monet | Irskaad: There were plenty of tiem rtavel episodes because chronitons were a bitch. |
| 21:53.25 | Monet | There was even a mirror universe wehre all the good guys were bad and all the baf guys were good. |
| 21:54.20 | DrodoEmpire | thus, starting one of the most popular "alternate timeline" themes in sci-fi. |
| 21:54.50 | Monet | I liked the Vokager feature-length episode "year of hell". |
| 21:55.11 | DrodoEmpire | BTW I'm not sure about the "Bad guys are good" thing, |
| 21:55.21 | The_Clanden | I did too, actually. |
| 21:55.27 | DrodoEmpire | I was a little more like "The Humans are worse". |
| 21:55.37 | DrodoEmpire | *It |
| 21:56.33 | Monet | You also had peopel like mirror Garak and mirror Kira who were aliens and complete jerks. |
| 21:56.58 | DrodoEmpire | There are bound to be that, |
| 21:57.13 | DrodoEmpire | A species doesn't have one single personality, |
| 21:57.21 | DrodoEmpire | one single ideology, |
| 21:57.41 | Monet | But the underlyingp rinciple was everything was reversed. Its jsut in the main series humans are generally good. |
| 21:57.58 | DrodoEmpire | Ya, |
| 21:58.31 | DrodoEmpire | The thing that irks me the most about Star trek, though, |
| 21:58.48 | DrodoEmpire | Is all of the one-note joke Empires. |
| 21:58.54 | DrodoEmpire | *Species. |
| 21:59.24 | Monet | My favourite line from Year of hell: First officer - Happy birthday captain | Captain - Happy what? |
| 21:59.44 | The_Clanden | The watch, right? |
| 21:59.49 | Monet | Yeah. |
| 22:00.36 | Monet | The crew had been so determined to just get through the area and survive that Janeway forgot that tiem of year it was. |
| 22:00.59 | Monet | Usually its the other way around. |
| 22:03.47 | The_Clanden | Then the dad from that 70's show went around constantly changing history. That was interesting. |
| 22:04.35 | Zmr56 | BYEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE |
| 22:04.47 | Zmr56 | Me go and murder some villians |
| 22:04.54 | DrodoEmpire | See ya, |
| 22:10.52 | Xho | "Due to this, many races in the universe accuse them of being Narrow-minded anti-theists." |
| 22:10.57 | Xho | Accusal is not an accurate word |
| 22:11.11 | Xho | *Accusatory meaning |
| 22:14.39 | OluapPlayer | xho dam u |
| 22:14.49 | OluapPlayer | I just remembered I wanted to show you stuff |
| 22:15.16 | OluapPlayer | Well, first of all |
| 22:15.17 | OluapPlayer | http://www.youtube.com/watch?v=OSCIjD7DWI0&feature=g-all-f PIE ROW GUN |
| 22:17.03 | Irskaad | Hey Ko did you win a lot? |
| 22:17.12 | Xho | Soldine |
| 22:17.17 | Xho | You're fucked nao boi |
| 22:19.11 | OluapPlayer | http://www.youtube.com/watch?v=TzxpbUeN-eg&feature=plcp This is what I wanted to show you |
| 22:19.23 | OluapPlayer | TF2 is gonna get a massive update soon |
| 22:19.41 | Irskaad | TI2 will start soon |
| 22:21.41 | *** join/#sporewiki Catface (46f2a3db@gateway/web/freenode/ip.70.242.163.219) |
| 22:21.55 | Catface | Hello my little clildren |
| 22:22.15 | Catface | Let me touch you let me feel |
| 22:22.26 | Xho | OluapPlayer: dis gon b gud |
| 22:22.26 | Catface | touches Cyrannian's face |
| 22:22.32 | Catface | Ahhh |
| 22:22.35 | OluapPlayer | yus |
| 22:23.15 | Cyrannian | neuters Catface with a hammer |
| 22:24.26 | Xho | Kugawattan is too good at this |
| 22:25.36 | Cyrannian | http://images3.wikia.nocookie.net/spore/images/7/7d/VoroAction.png - Voro'Acetee ready for combat |
| 22:26.18 | Catface | grows everything back |
| 22:26.23 | Irskaad | I thought he died |
| 22:26.50 | Cyrannian | He used a decoy |
| 22:26.59 | Irskaad | Oh |
| 22:27.04 | OluapPlayer | I like that weapon |
| 22:27.15 | OluapPlayer | And his pose |
| 22:29.13 | Catface | He looks like an angry person. |
| 22:30.08 | Cyrannian | Mmhm, he'll be cutting up some folks soon. |
| 22:31.48 | Catface | Will they get his point? |
| 22:33.17 | Cyrannian | Huh? |
| 22:35.29 | *** join/#sporewiki Monet (2ed0400f@gateway/web/qwebirc/irc.wikia.com/ip.46.208.64.15) |
| 22:35.42 | Hachi_ | Herro |
| 22:35.50 | OluapPlayer | hello |
| 22:36.17 | Hachi_ | Xho: What do you think of Foshi's Exodus Form? |
| 22:36.17 | Hachi_ | http://fc05.deviantart.net/fs70/i/2012/223/4/1/foshi___exodus_form_by_lotg-d5ar1vz.png |
| 22:36.30 | Monet | Hello |
| 22:37.48 | OluapPlayer | Hmm yeah, I can confirm now that TF2's ARG is back to activity |
| 22:37.53 | OluapPlayer | Something big IS coming |
| 22:38.38 | Catface | Hachi_ That looks like it could be the album art of some death metal band. |
| 22:40.29 | Hachi_ | Ooh thanks |
| 22:45.32 | OluapPlayer | Xho: http://www.youtube.com/watch?v=yMgnNI0Puxo&feature=g-all-f |
| 22:46.20 | *** join/#sporewiki Wormy (d92bf40d@gateway/web/freenode/ip.217.43.244.13) |
| 22:46.40 | Wormy | hi |
| 22:46.48 | Monet | Cyrannian: I take it by that new section on the Vartekian page that the might be more active soon? |
| 22:49.02 | Cyrannian | http://images3.wikia.nocookie.net/spore/images/2/2c/NovaOrtus.png - Coming soon. |
| 22:49.41 | Monet | That looks liek the cover of a bad album :> |
| 22:49.56 | OluapPlayer | Does that answer your question? |
| 22:49.58 | OluapPlayer | And lol |
| 22:50.28 | Monet | "new something" (my latin isn't perfect) |
| 22:50.33 | Irskaad | Dawwwwwwwwwwwwwww :3 |
| 22:50.42 | Cyrannian | New Rising |
| 22:50.48 | Hachi_ | I see a Vartekian |
| 22:50.57 | Hachi_ | Xanat - MY TIME TO SHINE BITCHES |
| 22:51.40 | Irskaad | Zavrhos - Hey, it's Xanatos Breek. How have you been doing? Killing some wealking Kraw? |
| 22:51.51 | Irskaad | (He still calls him Xanatos Breek) |
| 22:52.19 | Hachi_ | Xanat - It's Xanat now. And I've been training with the proud Vartekian race. |
| 22:52.20 | Catface | Monet: More like an ultra-low budget album. |
| 22:52.41 | Irskaad | Zavrhos - Xanat? Sounds like a bug pulverizing product. |
| 22:52.42 | Monet | Last I checked, neither of those two are great musicians/singers. |
| 22:53.18 | Cyrannian | They are generic Vartekians and Kicath, not individuals on the wiki |
| 22:54.27 | Irskaad | What are your most vintage characters? Mine are the 4 classics, Kies the paranoid, Lezia the annoying, Zavrhos the arrogant, and Eko the zealot |
| 22:54.34 | Monet | And Xho told me that Kicath aren't really made for sinigng. |
| 22:54.49 | Monet | Uriel's my oldest ever character. |
| 22:55.14 | Irskaad | Zavrhos - HA I'M BETTER THAN YOU BECAUSE I'M OLDER! I'M MORE VINTAGE! |
| 22:55.20 | Hachi_ | Moxix would be my oldest "somewhat-living" character |
| 22:55.24 | Hachi_ | Moxix - SO NYEH! |
| 22:56.04 | Irskaad | Lezia - Awww you're so cute, Mozzie! *Pets* I didn't get to meet you when you were alive, but you're still so cute! *Pets* |
| 22:56.17 | Monet | Uriel - You certainly don't act like it Zavrhos. |
| 22:56.28 | Irskaad | Zavrhos - What are you talking about? |
| 22:56.44 | Monet | Uriel - With age comes wisdom. Isn't it obvious? |
| 22:57.09 | Irskaad | Zavrhos - Yes. And I'm full of it! |
| 22:57.22 | Monet | Uriel - Then act it. |
| 22:57.45 | Irskaad | Zavrhos - Huh? I am! (To be fair this is how Iteok act like at any age) |
| 22:58.07 | Hachi_ | Moxix - Heh, well you're all doomed. |
| 22:58.17 | Irskaad | Lezia - *Keeps petting* |
| 22:58.22 | Wormy | IrsK: Sent a quote |
| 22:58.34 | Hachi_ | Brb |
| 22:59.11 | Irskaad | Wormy: Oshi DCP |
| 22:59.42 | *** join/#sporewiki Hachi_ (56938583@gateway/web/freenode/ip.86.147.133.131) |
| 22:59.43 | Hachi_ | And I'm back in the room |
| 23:00.10 | OluapPlayer | bleh |
| 23:00.33 | OluapPlayer | Most vintage? Carmetego, he's about as old as reality |
| 23:01.00 | Irskaad | I mean in wiki age, like, who did you make in 2009, 2009 is super-vintage |
| 23:01.08 | Catface | Xho: Everyone loves e minor. |
| 23:01.11 | OluapPlayer | Oh |
| 23:01.16 | OluapPlayer | I have no idea then |
| 23:01.26 | Wormy | I like her http://en.wikipedia.org/wiki/Mary_Elizabeth_Winstead |
| 23:01.29 | Hachi_ | My first ever character would be Lady Nix then. Pretty n00bish Zazane queen |
| 23:01.43 | Irskaad | She ruled with Moxix? |
| 23:01.59 | Monet | Dum I never made any Theian characters until 2012 :( |
| 23:02.12 | Hachi_ | No, Moxix killed the person who came after Nix |
| 23:02.17 | Hachi_ | Who was Kintus Jan |
| 23:02.27 | OluapPlayer | I guess my oldest char would be Koluap |
| 23:02.56 | Irskaad | So... Nyx- I mean Nix > Kintus > Moxix > Tyraz? |
| 23:03.04 | Hachi_ | Yeah |
| 23:03.30 | Cyrannian | Mine is probably Cretacea. |
| 23:03.37 | Irskaad | I renember all my questions on your Q/A blogs LotG |
| 23:03.47 | Catface | Mine is Tul |
| 23:03.59 | Irskaad | Back then I was all "WTF GODS IN SPOREWIKI ARE REAL WTF" |
| 23:04.52 | OluapPlayer | Koluap's page was made on January 2, 2011 |
| 23:05.03 | Monet | And now you kiss the feet of msot of the active ones, how times change. |
| 23:05.47 | Irskaad | It was 2 years ago |
| 23:06.02 | OluapPlayer | Hm no |
| 23:06.04 | OluapPlayer | Shu is my oldest char |
| 23:06.10 | Irskaad | Xhodocto were still extinct and Tyraz was ebul |
| 23:06.12 | OluapPlayer | His page was made on March 27, 2010 |
| 23:06.18 | Irskaad | Shu AKA Nightmare |
| 23:07.07 | Hachi_ | http://images3.wikia.nocookie.net/__cb20120511012329/asuraswrath/images/b/ba/Asura_The_Destructor_%282%29.png Would you believe this dude hates being called a god? |
| 23:07.30 | Irskaad | Wow. |
| 23:19.12 | Wormy | Irskaad: I know I had a blog like that. In the infinte Omniverse there must be Xhodocto. Luckily we are shielded by the very infinity that allows them to exist. |
| 23:20.07 | Wormy | It also means there is a universe where the Xeelee Sequence is real |
| 23:20.27 | Wormy | Its time I build an interuniversal drive |
| 23:22.57 | Hachi_ | Monet: Have you seen Psycho Mantis' death? |
| 23:23.27 | Monet | Hachi_: No I haven't. |
| 23:23.45 | Hachi_ | Well when you do, prepare yourself. Its quite emotionally devastating |
| 23:24.49 | Irskaad | Who's Psycho Mantis |
| 23:25.41 | Hachi_ | http://images4.wikia.nocookie.net/__cb57524/metalgear/images/6/6a/Psycho_Mantis.jpg This skinny bastard |
| 23:25.52 | Monet | He's the final boss of Metal Gear Solid. |
| 23:26.08 | Monet | And he is quite the piece ofwork. |
| 23:27.07 | Hachi_ | He's not final boss? |
| 23:27.25 | Hachi_ | Well in Twin Snakes he's not |
| 23:27.36 | Monet | In the original he was I believe. |
| 23:27.56 | Hachi_ | Hmm okaii |
| 23:28.25 | Monet | I might be thinking of Big Boss. |
| 23:28.37 | Hachi_ | Yeah |
| 23:28.41 | Hachi_ | It was Big Boss |
| 23:28.44 | Monet | Since MGS1 takes place i nhis pet-project of Outer heaven. |
| 23:29.00 | Hachi_ | Psycho Mantis is part of FOXHOUND |
| 23:32.21 | Wormy | This is the best fighting tune ever http://www.youtube.com/watch?v=Q53CNvFg9Fw |
| 23:36.36 | *** join/#sporewiki DrodoEmpire (8e44b7b0@gateway/web/freenode/ip.142.68.183.176) |
| 23:36.49 | DrodoEmpire | Hello, everyone. |
| 23:37.24 | Wormy | hi |
| 23:38.13 | Monet | Hello |
| 23:39.09 | Cyrannian | http://spore.wikia.com/wiki/Fiction:Nova_Ortus - c |
| 23:39.15 | Catface | no |
| 23:40.15 | Hachi_ | Exclusive to hivemind? :c |
| 23:40.17 | Monet | "Provocation: Rise of the Vartekian and Kicath" >> AGC - U gotta be kiddin' us. |
| 23:40.41 | Irskaad | Yay Kicaths |
| 23:41.18 | Wormy | The DCP and Vartekians have always had a strange relationship |
| 23:41.41 | Cyrannian | Well, now they are going to be very busy. |
| 23:44.54 | Monet | Personally I am wetting myself with dread. |
| 23:45.03 | Wormy | another epic song http://www.youtube.com/watch?v=-hwiCkU73NA&feature=endscreen&NR=1 |
| 23:45.20 | OluapPlayer | Dread yourself, hm? |
| 23:45.24 | OluapPlayer | http://images3.wikia.nocookie.net/spore/images/9/96/Chosen_Spoiler.png Lemme help you with that |
| 23:46.07 | Wormy | ItsExodium everyone needs to worry about now. |
| 23:46.37 | Irskaad | Moar Chosen Moar Vartekkies Moar Kicaths |
| 23:46.44 | Monet | Well apparently shit's going down with Vartekians and Kicath and plot means the AGC cannot intervene whatever happens. |
| 23:46.47 | Irskaad | I'm wetting myself with joy |
| 23:47.08 | Cyrannian | Yes, I had the feeling you would. |
| 23:47.15 | Wormy | You should see the doctor about that. |
| 23:47.22 | Irskaad | hur |
| 23:47.46 | Cyrannian | ~poke Wormy |
| 23:47.47 | infobot | ACTION cuts down a small tree, sneaks up behind Wormy, pokes Wormy repeatedly, hilarity ensues. |
| 23:48.10 | Wormy | wets himself with glee |
| 23:48.26 | OluapPlayer | dum, only Irsk commented on the picture I took so long to make |
| 23:48.43 | DrodoEmpire | Y IZ EVERYONE WETTING THEMSELVES!!!!1111!!!!!??? |
| 23:48.46 | Cyrannian | OluapPlayer: I like it! |
| 23:48.49 | Wormy | Its is great as always |
| 23:48.50 | Irskaad | I'm a dedicated corruptus fangirl |
| 23:49.09 | OluapPlayer | There's no denying that |
| 23:49.19 | Wormy | Music in Kill Bill is epic http://www.youtube.com/watch?v=-hwiCkU73NA&feature=endscreen&NR=1 |
| 23:49.25 | Monet | Still, Luc Imperios and I have our own plans for the AGC. |
| 23:49.36 | Wormy | Woops I posted that vid already |
| 23:49.40 | Cyrannian | It has nothing to do with the AGC |
| 23:49.46 | Irskaad | Xho is too awsum for that :3 |
| 23:49.47 | OluapPlayer | Hachi_: buni will be face to face with that picture |
| 23:49.56 | Hachi_ | Eeek |
| 23:50.16 | Monet | I never said this New Rising would. |
| 23:50.50 | Wormy | Cyra: Can you link me that story of ours? |
| 23:50.56 | Cyrannian | Aye |
| 23:51.04 | Wormy | I'll start a chapter |
| 23:51.11 | Cyrannian | http://spore.wikia.com/wiki/Fiction:Dark_Times/Year_Two/Amemoriam |
| 23:51.12 | Hachi_ | Hachi will be fightin dem Chosen? |
| 23:51.18 | OluapPlayer | Yes |
| 23:51.31 | OluapPlayer | He'll be a key char |
| 23:51.37 | Hachi_ | Oooh noic |
| 23:52.23 | OluapPlayer | I expected Monet to comment on the picture |
| 23:52.53 | *** join/#sporewiki GreatDestroyer12 (70ca8bb5@gateway/web/qwebirc/irc.wikia.com/ip.112.202.139.181) |
| 23:52.54 | Cyrannian | Wormy: The indepth bit is optional, that's usually were I put roleplays if they are needed |
| 23:53.04 | DrodoEmpire | Hello, |
| 23:53.04 | GreatDestroyer12 | hello all |
| 23:53.12 | Hachi_ | Wait, is that Shu'ytgrova? |
| 23:53.19 | Hachi_ | Or however you spell his name |
| 23:53.32 | Wormy | Roleplays might be needed when my fiction communicates with yours |
| 23:53.36 | OluapPlayer | That's Emperor Marigrax |
| 23:53.38 | Irskaad | Shu'ytrogarva* |
| 23:53.42 | Hachi_ | Riiight |
| 23:53.48 | Hachi_ | Hachi - *shits self* |
| 23:53.53 | OluapPlayer | [[Captain:Emperor Marigrax]] |
| 23:53.54 | morgothBotPy | OluapPlayer meant: http://spore.wikia.com/wiki/Captain:Emperor_Marigrax |
| 23:54.08 | DrodoEmpire | GreatDestroyer12: It was almost 5 in the morning before I got to sleep, |
| 23:54.22 | GreatDestroyer12 | wow |
| 23:54.24 | DrodoEmpire | Then I woke up at 1 in the afternoon, |
| 23:54.36 | DrodoEmpire | I got exactly eight hours of sleep. |
| 23:54.40 | DrodoEmpire | :3 |
| 23:54.45 | GreatDestroyer12 | haha |
| 23:54.48 | Hachi_ | Hachi is going to be fighting Marigrax himself, huh? |
| 23:54.57 | OluapPlayer | Hachi & friends |
| 23:55.07 | GreatDestroyer12 | i saved all out convos from last night |
| 23:55.27 | DrodoEmpire | BTW ever play Homeworld? |
| 23:55.29 | OluapPlayer | He'll have to pass through Geltastra too |
| 23:55.34 | GreatDestroyer12 | yup |
| 23:55.34 | GreatDestroyer12 | 1 and 2 |
| 23:55.42 | DrodoEmpire | Good games, |
| 23:55.43 | Monet | Tentacles! |
| 23:55.48 | Hachi_ | Hachi & Friends vs Geltastra & Tentacles |
| 23:56.20 | OluapPlayer | The Champions, the Acolyte, Murangon Nal, Geltastra and Marigrax |
| 23:57.12 | Irskaad | is glad Champions can respawn :3 |
| 23:57.12 | OluapPlayer | Yoo gonna get indoctrinated |
| 23:57.14 | Monet | BTW Xho where would you prefer the Kicath to be in Andromeda? http://images.wikia.com/spore/images/0/07/AndromedaEmpireMap.png |
| 23:57.18 | DrodoEmpire | Wormy: I think I found the perfect theme for the Hogomoths, |
| 23:57.27 | OluapPlayer | Xho's not here |
| 23:57.36 | Irskaad | Xho - dunno u dai nao ~smack OluapPlayer |
| 23:57.41 | Monet | Dum I thought he was! |
| 23:57.46 | Hachi_ | Brood of War small |
| 23:57.48 | Wormy | Ooh, show me? |
| 23:57.52 | DrodoEmpire | k |
| 23:57.54 | OluapPlayer | You must have confused me and Cyrannian with him |
| 23:57.58 | OluapPlayer | It's completely normal |
| 23:58.03 | DrodoEmpire | http://www.youtube.com/watch?v=hOJaXybK4_A |
| 23:58.21 | Monet | No wait I know, he must have left while I was updating Andromeda. |
| 23:58.52 | OluapPlayer | he timed out almost 45 minutes ago |
| 23:59.07 | Irskaad | All hail the 2nd Imperium of Asharta! |
| 23:59.14 | Cyrannian | They'd be near Vartekian space. |
| 23:59.44 | Monet | Oh well was going to make a new-look Andromeda anyway. |